Biology

Permanent URI for this collection

https://hdl.handle.net/20.500.11888/3203

Browse

Recent Submissions

Now showing 1 - 5 of 82
  • Thumbnail Image
    Item
    EVALUATING TOXOPLASMOSIS GENO-PREVALENCE IN SLAUGHTERED SHEEP USING PCR METHOD IN NORTHERN PALESTINE
    (2022-08-25) Hidaya Abdul-Aziz Mohammad Qash
    Background: Toxoplasmosis is a worldwide zoonotic disease due to Toxoplasma gondii; it affects warm-blooded animals, including sheep and humans. Ingesting free-range undercooked meat of livestock, specifically sheep, is highly associated with human toxoplasmosis. At least 30% of people in most developing countries are positive for IgG antibodies to T. gondii. This parasite affects women and increases the chance of abortion due to damage to the fetus’s central nervous system via causing dangerous defects in newborns. Methodology: 1062 sheep’s tissues (252 liver, 74 lungs, 280 heart, 254 brain, and 202 tongue) were randomly obtained from 346 sheep (ram and ewe) and they were slaughtered in the abattoirs of Nablus and Jenin. These tissues were examined for the presence of deoxynuclease amino acid (DNA) for T.gondii DNA extracted from the lung, liver, brain, tongue, and heart of sheep using the phenol-chloroform-isoamyl alcohol (PCI) method. Extracted DNA was examined for the presence of TOX4/TOX5 genes (non-coding fragment, repeated 200-300-fold). Polymerase chain reaction (PCR) was used to visualize and analyze the forward (5′ CGCTGCAGGGAGAAGTTG3′) and reverse (5′ CGCTGCAGACACAGTGCATCTGGATT3′) amplicons. Results: Geno-positive PCR results were found in 25.72% (89/346) of sheep. The total infection rate within Jenin was 19.27% (28/162), whereas it was 29.44% (53/180) in Nablus. The highest was found in Nablus. Data analysis showed that the overall infection rates in heart, brain, liver, tongue, and lung samples were 7.86% (22/280), 2.36% (6/254), 4.76% (12/252), 20.79% (44/202), and 21.78% (8/37), respectively. Among the samples successfully genotyped for T.gondii (89 sheep), 16 of them had two infected tissues, and one of these tissues was the tongue. The results demonstrated the presence of T.gondii DNA in tissues of slaughtered sheep from the northern area of the west bank. The highest percentage rate was recorded in the tongue, so that it is mostly causative of a high risk of toxoplasmosis. Ewes have a higher infection rate compared with rams. Conclusions : Due to the high rate of toxoplasmosis among the slaughtered animals as well as meat products specially in tongue, consuming under-cooked meat obtained from infected sheep can be one of the main risk factors of transmission of the parasite to humans. It is necessary to avoid eating the raw and undercooked tissues of animals. Keywords: PCR; Palestine; T.gondii; Toxoplasmosis; TOXO4/TOXO5; Geno-prevalence.
  • Thumbnail Image
    Item
  • Thumbnail Image
    Item
    THE ANTIBACTERIAL EFFECT OF DIFFERENT PALESTINIAN OAK SPECIES ON MRSA
    (2022-08-31) Renada Shafik Razmaq
    Introduction: The most common cause of nosocomial pneumonia is staphylococcus aureus, with substantial mortality and morbidity. The growing bacterial resistance and side effects of antimicrobial medications have led to significant attention being paid to traditional medicinal plants in the past few decades. Compounds, derived from these plants, can be used to treat microbial infections as an alternative treatment. Objective: The main aim of this study was to determine the potential antimicrobial effects of ethanol and aqueous extracts of three different species of Quercus against MRSA isolates. Methods: Antibacterial activity of plant extracts was observed, using the agar well diffusion test.After observation, the researcher determined the Minimum Inhibitory Concentration (MIC) by 2-fold dilution of plant extracts yielding a serial dilution of the original extract. To check if the desired compound entered the site of infection in vivo and reached high levels to alter bacterial viability, mice were used as animal models of infection. Results: Ten extractions (water and ethanol) were prepared from the three oak species. However, only seven showed MICs ranging between 1.56-12.5 mg/ml. In vivo testing showed an indication of bacterial inhibition ability of Q.coccifera extract (0.22 mg/ml) when added to the drinking water of a mice group. The bacterial count from a cultured swab from this group of infected mice was 160 CFU, the lowest count of all extracts. Conclusions: Ethanol extracts of oak have more efficient antibacterial activity than water extracts. Water extracts, when mixed with the drinking water of mice, have a good antibacterial inhibitory ability. Future studies should be conducted to extract oak's active ingredients using other solvents. Also, combining these extracts with other antibiotics might enhance their effect in vivo. Keywords: MRSA; Quercus;Palestine; antibiotic resistance; plant extract; MIC;animal model.
  • Thumbnail Image
    Item
    Medicinal Plants as a Source of Inhibitors of the Digestive Enzymes: Alpha-glucosidase, Alpha-amylase and Pancreatic Lipase
    (Raghad Albzoor, 2019-03-21) Albzoor, Raghad
    Obesity and diabetes are reaching epidemic proportions all over the world in the twenty-first century. Herbal medicine has been suggested as an alternative source of potentially useful antihyperlipidemic and antihyperglycemic agents. The objective of this study was to assess in vitro the inhibitory activity of selected local anti-diabetic and anti-obesity medicinal plants on carbohydrate and lipid digestive enzymes namely, α-glucosidase, pancreatic α-amylase, and pancreatic lipase. The inhibitory activities of ethanol: water (50%:50%) six herbal extracts (namely: Allium sativum, Allium cepa, Atriplex halimus, Cinnamomum cassia, Olea europaea and Trigonella foenum-graecum) were evaluated using the enzymatic colorimetric assays. Among the six herbal extracts (at a concentration of 200 µg/ml), only A. sativum (bulb) showed an inhibitory activity against the intestinal sucrase (α-glucosidase) with a percentage inhibition of 46.74±11.55% (p<0.01). For pancreatic lipase only C. cassia (bark) showed an inhibitory activity with a percentage inhibition of 14.33±4.98% (p<0.05). The highest inhibitory percentage was received by C. cassia (bark) and O. europaea (leaves) on pancreatic α-amylase with IC50 value 24±3.01 and 192.94±6.4 µg/mL, respectively. Taken together, these results indicate that the above mentioned plants can be potentially useful to treat diabetes or obesity. Further studies are needed for identification of the chemical composition and therapeutic effect of these plants and to identify the active ingredients responsible for these activities. In vivo tests are also required to examine other mechanisms responsible for the activity of these plants as antiobesity and antidiabetic agents.
  • Thumbnail Image
    Item
    Biochemical and Molecular Evaluation of the Plant Ecballium elaterium Extract Effects on Escherichia coli
    (Wafa Jarrah Abdat, 2018-05-02) Abdat, Wafa
    Ecballium elaterium plant is traditionally used in several countries around the world for the treatment of various illnesses including jaundice and rhinosinusitis. The present study was conducted to investigate the antimicrobial activity of fruit and leaf ethanolic extracts of E. elateruim on clinical and reference strains of E. coli. Microbroth dilution method indicated that ethanolic leaf and fruit extracts of E. elaterium exhibited the same degree of antimicrobial activity against both tested E. coli strains with an MIC value of 25mg/ml. The effect of E. elaterium ethanolic extracts on these strains was also examined at the molecular level using ERIC-PCR. SDS-PAGE technique was also carried out to examine gene expression of total cellular proteins under the same conditions. Results of ERIC-PCR and SDS-PAGE showed alterations in DNA and protein profiles of both tested E. coli strains treated with fruit and leaf extracts compared with untreated control. The alterations ranged between decreased or increased intensity of some bands, absence or appearance of new amplified fragments. Among the changes that occurred in ERIC-PCR profile, an amplified fragment with amplicon size 450-bp disappeared after 6 and 24h from reference strain treated with 6 mg/ml fruit extract compared with untreated control. The band which had an amplicon size of about 550-bp was faint after 2h in clinical strain treated with 25 mg/ml ethanolic leaf extract in comparison with untreated control. In addition, after 6h treatment of reference E. coli with 25 mg/ml leaf extract appearance of extra new bands at Rf values of approximately 0.45 and 0.47 was recorded compared with untreated control in SDS-PAGE profile. SDS-PAGE profile also revealed the increase in the intensity of bands at approximate Rf values of 0.15 and 0.7 compared after 6 h treatment of clinical E. coli with 10 and 6 mg/ml fruit extract with untreated control. Moreover, increased concentrations of E. elaterium extracts and increased time intervals seems to yield a more profound increase in total protein concentrations in both tested E. coli strains. Such findings strongly indicate the genotoxic effects of E. elaterium extracts on both E. coli strains. The findings draw attention to the unsafe improper use of E. elaterium extracts in folkloric medicine and also point out the capability of using E. elaterium to treat E. coli infections. More studies are required to find out the exact mechanisms responsible for the observed genotoxicity.