EVALUATING TOXOPLASMOSIS GENO-PREVALENCE IN SLAUGHTERED SHEEP USING PCR METHOD IN NORTHERN PALESTINE
Loading...
Date
Authors
Journal Title
Journal ISSN
Volume Title
Publisher
Abstract
Background: Toxoplasmosis is a worldwide zoonotic disease due to Toxoplasma gondii; it affects warm-blooded animals, including sheep and humans. Ingesting free-range undercooked meat of livestock, specifically sheep, is highly associated with human toxoplasmosis. At least 30% of people in most developing countries are positive for IgG antibodies to T. gondii. This parasite affects women and increases the chance of abortion due to damage to the fetus’s central nervous system via causing dangerous defects in newborns.
Methodology: 1062 sheep’s tissues (252 liver, 74 lungs, 280 heart, 254 brain, and 202 tongue) were randomly obtained from 346 sheep (ram and ewe) and they were slaughtered in the abattoirs of Nablus and Jenin. These tissues were examined for the presence of deoxynuclease amino acid (DNA) for T.gondii DNA extracted from the lung, liver, brain, tongue, and heart of sheep using the phenol-chloroform-isoamyl alcohol (PCI) method. Extracted DNA was examined for the presence of TOX4/TOX5 genes (non-coding fragment, repeated 200-300-fold). Polymerase chain reaction (PCR) was used to visualize and analyze the forward (5′ CGCTGCAGGGAGAAGTTG3′) and reverse (5′ CGCTGCAGACACAGTGCATCTGGATT3′) amplicons.
Results: Geno-positive PCR results were found in 25.72% (89/346) of sheep. The total infection rate within Jenin was 19.27% (28/162), whereas it was 29.44% (53/180) in Nablus. The highest was found in Nablus. Data analysis showed that the overall infection rates in heart, brain, liver, tongue, and lung samples were 7.86% (22/280), 2.36% (6/254), 4.76% (12/252), 20.79% (44/202), and 21.78% (8/37), respectively. Among the samples successfully genotyped for T.gondii (89 sheep), 16 of them had two infected tissues, and one of these tissues was the tongue. The results demonstrated the presence of T.gondii DNA in tissues of slaughtered sheep from the northern area of the west bank. The highest percentage rate was recorded in the tongue, so that it is mostly causative of a high risk of toxoplasmosis. Ewes have a higher infection rate compared with rams.
Conclusions : Due to the high rate of toxoplasmosis among the slaughtered animals as well as meat products specially in tongue, consuming under-cooked meat obtained from infected sheep can be one of the main risk factors of transmission of the parasite to humans. It is necessary to avoid eating the raw and undercooked tissues of animals.
Keywords: PCR; Palestine; T.gondii; Toxoplasmosis; TOXO4/TOXO5; Geno-prevalence.