The use of Immunocaptured Polymerase Chain Reaction (ICPCR) to Study the Translocation of Tomato Yellow Leaf Curl Virus (TYLCV) in Tomato Plants

Abstract

<p>Translocation of TYLCV was studied in tomato plants after whitefly-mediated inoculation at3-4 true leaf stage. Therefore, twenty healthy tomato plants were grown under laboratoryconditions at 25-30 degree Celsius. Whitefly-mediated inoculated was employed using adultinsects raised for two generation on TYLCV–immune plants including eggplant and pumpkin.The virus was acquired by the whiteflies after an access period of 48-hr on TYLCV-infectedjimsonweeds. Inoculation of tomato test plants was done by caging the third top leaf of eachplant with ten whiteflies using leaf cages or perforated plastic bottles. After 24 hr feedingaccess, the whiteflies were killed (Pico et. al. 1996, Sawalha, 2009b).Tissue samples were collected at different intervals from the inoculated leaves, leaf petioles,stems, roots and top leaves. The samples were kept frozen at -20 degree Celsius and thentested by IC-PCR. Healthy tissues were obtained from control plants (eight tomato plants)grown and treated similarly (Sawalha, 2009c).The IC-PCR was employed as described by Sawalha (2000) using TYLCV-specificpolyclonal IgG. The reaction was employed as described by Navot et. al. (1992), Campbelland Reece (2005) and Tortora et. al. (2002) using TYLCV-specific oligonucleotide primers.Sub-genomic fragments of the virus genome were amplified. The primers were purchasedfrom the Alltech Company, Paisley, UK. The primer sequences were from 5’ to 3’, P1V,ATACTTGGACACCTAATGGC, nucleotides (nt) 61-80, and P4C,TGGACATCTAGACCTAAG, nt. 2054-2071. The sequence of the P1V corresponds to theviron positive strand, whereas the P4C is complementary to the viron strand. Results wererecorded as described by Sawalha (2000) and Sawalha (2009a).Based on the PCR results, the virus needed 12 hours to pass through the petioles of theinoculated leaves then two days to reach the tap root of the inoculated plants. In addition, thevirus translocated upward and needed three days after inoculation to invade the upper mosttop leaves then one and two days later to arrive the second and the third most upper leaves.Furthermore, the virus needed twelve days to make an invasion for the most plant parts.Determining the translocation rate of the virus particles revealed that they move in averagerates of 78 mm/day from inoculated leaves downward toward the root and 182 mm/dayupward from root to the top part of shoot</p>
<p>Translocation of TYLCV was studied in tomato plants after whitefly-mediated inoculation at3-4 true leaf stage. Therefore, twenty healthy tomato plants were grown under laboratoryconditions at 25-30 degree Celsius. Whitefly-mediated inoculated was employed using adultinsects raised for two generation on TYLCV–immune plants including eggplant and pumpkin.The virus was acquired by the whiteflies after an access period of 48-hr on TYLCV-infectedjimsonweeds. Inoculation of tomato test plants was done by caging the third top leaf of eachplant with ten whiteflies using leaf cages or perforated plastic bottles. After 24 hr feedingaccess, the whiteflies were killed (Pico et. al. 1996, Sawalha, 2009b).Tissue samples were collected at different intervals from the inoculated leaves, leaf petioles,stems, roots and top leaves. The samples were kept frozen at -20 degree Celsius and thentested by IC-PCR. Healthy tissues were obtained from control plants (eight tomato plants)grown and treated similarly (Sawalha, 2009c).The IC-PCR was employed as described by Sawalha (2000) using TYLCV-specificpolyclonal IgG. The reaction was employed as described by Navot et. al. (1992), Campbelland Reece (2005) and Tortora et. al. (2002) using TYLCV-specific oligonucleotide primers.Sub-genomic fragments of the virus genome were amplified. The primers were purchasedfrom the Alltech Company, Paisley, UK. The primer sequences were from 5’ to 3’, P1V,ATACTTGGACACCTAATGGC, nucleotides (nt) 61-80, and P4C,TGGACATCTAGACCTAAG, nt. 2054-2071. The sequence of the P1V corresponds to theviron positive strand, whereas the P4C is complementary to the viron strand. Results wererecorded as described by Sawalha (2000) and Sawalha (2009a).Based on the PCR results, the virus needed 12 hours to pass through the petioles of theinoculated leaves then two days to reach the tap root of the inoculated plants. In addition, thevirus translocated upward and needed three days after inoculation to invade the upper mosttop leaves then one and two days later to arrive the second and the third most upper leaves.Furthermore, the virus needed twelve days to make an invasion for the most plant parts.Determining the translocation rate of the virus particles revealed that they move in averagerates of 78 mm/day from inoculated leaves downward toward the root and 182 mm/dayupward from root to the top part of shoot</p>

Description

Keywords

Citation

Endorsement

Review

Supplemented By

Referenced By