An-Najah National University Faculty of Graduate Studies Molecular Characterization of Salmonella Enterica Serotype Typhimurium and Enteritidis Isolates from Food Samples in West Bank / Palestine By Omayma Mahmoud Khreishi Supervisor Prof. Ghaleb Adwan Co-Supervisor Dr. Sameh Abuseir This Thesis is Submitted in Partial Fulfillment of the Requirements for the Master Degree in Public Health, Faculty of Graduate Studies, An-Najah National University, Nablus, Palestine. 2021 ii Molecular Characterization of Salmonella Enterica Serotype Typhimurium and Enteritidis Isolates from Food Samples in West Bank / Palestine By Omayma Mahmoud Khreishi This thesis was defended successfully on 30/12/2021 and approved by: Defense Committee Members Signature 1. Prof. Ghaleb Adwan \ Supervisor 2. Dr. Sameh Abuseir \ Co-Supervisor 3. Dr. Wafa Masoud \ External Examiner 4. Dr. Mohammad Al-Tamimi \ Internal Examiner iii Dedication I would dedicate my sincere appreciation to my precious mother and father who have always encouraged me to move forward and always were there for me when I needed them. I also dedicate this dissertation to my loving sisters and brothers who were always standing by my side. I will always appreciate all what they have done. And, to my dear friends who always supported me and were always there for me, great love and thanks to them. And special thanks to my work colleagues in Qalqelyia who always supported me and gave me convenience while working on this research. iv Acknowledgement I would like to express my deep gratitude and respect to my supervisor Prof. Ghaleb Adwan for his help, guidance, encouragement, patience, and understanding while undertaking this study despite the challenges that we encountered but we managed to overcome such difficult times. Much thanks to him for being with me from the beginning of the research. I would also like to give a special thanks to my Co-supervisor Dr. Sameh Abuseir for giving me this chance and for his guidance and support from the beginning, I really appreciate it and much grateful. I would also like to thank my dear university (An-Najah National University) for being supportive and kindness to assist me throughout the course of my study. And special thanks to my dear instructors in the faculty of Agriculture and Veterinary Medicine for their support. I would also like to acknowledge Dr. Amjad Hussein for his assistance in collecting the samples and conducting the laboratory experiments in the Chemical, Biological and Drugs Analysis Center at An-Najah National University. Also, a special thanks to all my dear friends in the Master Program. I appreciate all kinds of help they gave me. Special thanks to all my instructors who helped me since my first day at the university at the Faculty of Graduate Studies, much love to their support. v االقرار :العنوانل الموقعة أدناه مقدمة الرسالة التي تحم أنا Molecular Characterization of Salmonella Enterica Serotype Typhimurium and Enteritidis Isolates from Food Samples in West Bank / Palestine التوصيف الجزيئي لعزالت السالمونيال المعوية من النمط المصلي Typhimurium وEnteritidis من عينات الغذاء فلسطين/ في الضفة الغربية إليه اإلشارة تما تم ،باستثناء الخاص جهدي نتاج هي إنما الرسالة هذه عليه تما اشتمل بأن أقر وعملية أ درجةأية لنيل قبل من يقدم لم منها جزء أي أو ككل، الرسالة هذه وإن ،دما ور حيث .ىبحثية أخر أو تعليمية مؤسسة أية لدى وبحثيعلميا لقب Declaration The work provided in this thesis, unless otherwise referenced, is the researcher's own work, and has not been submitted elsewhere for any other degree or qualification. vi Table of Contents No. Content Page Dedication iii Acknowledgements iv Declaration v Table of Contents Vi List of Tables viii List of Figures ix List of Abbreviations x Abstract xiv Chapter One: Introduction 1 1.1 General background 2 1.1.1 Salmonella infections (Salmonellosis) 2 1.1.2 Nomenclature/Taxonomy 6 1.1.3 Morphology, Bacteriological Culture, and Isolation Procedures 7 1.1.4 Salmonella Typhimurium and Salmonella Enteritidis 9 1.1.5 PCR-based typing methods 13 1.1.6 Virulence gene typing 17 1.2 Aims of the study 18 Chapter Two: Materials and Methods 20 2.1 Samples collection 21 2.2 DNA isolation and PCR technique 22 2.2.1 DNA extraction 22 2.2.2 Salmonellae spp. confirmation and S. typhimurium and S. Enteritidis identification by multiplex PCR (mPCR) 22 2.2.3 Molecular typing of S. Typhimurium by ERIC- PCR and BOXAIR-PCR 24 2.2.4 Molecular typing of S. Typhimurium by RAPD-PCR 26 2.2.5 Virulotyping of S. Typhimurium isolates by multiplex PCR (mPCR) 26 Chapter Three: Results 30 3.1 Salmonella spp. confirmation and S. Typhimurium and S. Enteritidis detection 31 3.2 Virulotyping of S. Typhimurium serotype isolates by multiplex PCR (mPCR) 33 3.3 Genotyping of S. Typhimurium serotype by PCR- based methods 35 Chapter Four: Discussion 40 Conclusion 54 vii No. Content Page Recommendations 55 References 56 ب الملخص viii List of Tables No. Table Page Table (1.1) Function of virulence factors of S. Typhimurium used in virulence genotyping in this study (Skyberg et al., 2006). 18 Table (2.1) Oligonucleotide primers used for Salmonella spp. confirmation, S. Typhimurium and S. Enteritidis detection. 24 Table (2.2) Virulence gene primers used in this study (Skyberg et al., 2006). 28 Table (3.1) Occurrence of S. Typhimurium serotype among Salmonella spp. isolated from different types of food samples. 33 Table (3.2) Virulence gene profile of 28 S. Typhimurium isolated from different types of food samples 35 Table (3.3) Relationship between the clones or the clusters depending on the number of different bands based on ERIC-PCR profile of 16 S. Typhimurium serotype isolates. 37 Table (3.4) Relationship between the clones or the clusters depending on the number of different bands based on BOX-PCR profile of 16 S. Typhimurium serotype isolates. 39 ix List of Figures No. Figure Page Figure (3.1) Multiplex PCR profile specific for genes responsible for detection isolates of Salmonella genus, (invA gene; 404-bp) S. Typhimurium serotype (STMO159, a putative restriction endonuclease; 224-bp) and S. Enteritidis (SEN1383, a hypothetical protein; 304-bp). 32 Figure (3.2) Multiplex PCR profiles specific for S. Typhimurium virulence factors. 34 Figure (3.3) DNA fingerprint patterns generated by ERIC- PCR typing of 16 S. Typhimurium serotype isolates recovered from different food samples electrophoresed in a 1.5% agarose. 36 Figure (3.4) Dendrogram of 16 S. Typhimurium serotype isolates based on the UPGMA method using Average linkage (between groups)/Squared Euclidean Distance by SPSS software version 20. 36 Figure (3.5) DNA fingerprint patterns generated by BOX- PCR typing of 16 S. Typhimurium serotype isolates recovered from different food samples electrophoresed in a 1.5% agarose. 38 Figure (3.6) Dendrogram of 16 S. Typhimurium serotype isolates based on the UPGMA method using Average linkage (between groups)/Squared Euclidean Distance by SPSS software version 20. 38 x List of Abbreviations Symbol Abbreviation PCR Polymerase Chain Reaction mPCR Multiplex- Polymerase Chain Reaction REP-PCR Repetitive Extragenic Palindromic Sequences- Polymerase Chain Reaction RAPD-PCR Random Amplification of Polymorphic DNA- Polymerase Chain Reaction ERIC-PCR Enterobacterial Repetitive Intergenic Consensus- Polymerase Chain Reaction BOXAIR-PCR A primer corresponding to the BOXA subunit of the BOX element PCR WHO World Health Organization EFSA European Food Safety Authority ECDC European Centre for Disease Prevention and Control S. Salmonella V Virulotype Spp. Species LPS Lipopolysaccharides C Cluster or Clone n Number No. Number L Lane var Serovar H2S Hydrogen Sulfide NTS Non Typhoidal Salmonella antisera Antiserum EU European Union Subsp. Subspecies MS Mass Spectrometry DNA Deoxyribonucleic acid xi AFLP Amplified Fragment Length Polymorphism PFGE Pulsed-Field Gel Electrophoresis PCR-RFLP Polymerase Chain Reaction-Restriction Fragment Length Polymorphism SDS-PAGE Sodium Dodecyl Sulphate-Polyacrylamide Gel Electrophoresis PU Palindromic Units MLST Multilocus Sequence Typing BOX Box Element PCR REP Repetitive Extragenic Palindromes SE Salmonella Enteritidis ST Salmonella Typhimurium MgCl2 Magnesium Chloride Mg2+ Magnesium ion TSI Triple Sugar Iron SIM Sulfide-Indole-Motility test ATCC25922 Nonpathogenic Strain of Escherichia Coli pH A scale of acidity from 0 to 14 Tris-HCl (hydroxymethyl) aminomethane (THAM) hydrochloride mM Millimole min. Minutes g Gram s Seconds µM Micro Molar µl Micro liter bp Base pair µg/ml Microgram per Milliliter U Unite ng Nanogram ºC Degree Celsius xii et al. and others DMSO Dimethyl sulfoxide rDNA Ribosomal DNA dNTPs Deoxynucleoside triphosphate TM Melting Temperature STMO159 A putative restriction endonuclease for S. Typhimurium SEN1383 A hypothetical protein for S. Enteritidis Taq Thermus Aquaticus DNA Polymerase UV Ultraviolet E. coli Escherichia Coli P.aeruginosa Pseudomonas aeruginosa X Times Tris-EDTA Ethylenediamine Tetraacetic Acid; buffered solution GTG Giemsa-Trypsin-Giemsa /poly-trinucleotide T3SS Type III secretion systems SSCP Single-Strand Conformation Polymorphism SPIs Salmonella Pathogenicity Islands PAIs Pathogenicity Islands or Pathogenicity Islets S.1,4,[5],12:i: A Monophasic Variant of Salmonella Typhimurium H antigen Flagellar antigen O antigen Somatic antigen K antigen Capsular polysaccharide antigen TTSS Type III Secretion System SPSS Statistical Package for the Social Sciences UPGMA Unweighted Pair Group Method for Arithmetic Averages SPI Salmonella Pathogenicity Island ESBLs Extended-spectrum beta-lactamases MBLs Metallo-β-Lactamases β-lactamases Beta-lactamases xiii MLVA Multiple locus variable number of tandem repeats analysis MSC Masters of Sciences pUO-StVR2. Virulence-resistance plasmid which originated from pSLT of Salmonella enterica serovar Typhimurium Vi antigen Capsular protein antigens / Virulence antigen invA Invasion gene A IBM International Business Machines Corporation OPP-16 RAPD Primer/Genetic marker F Forward R Reverse spv Salmonella plasmid virulence pefA Plasmid encoded fimbriae A sitC Salmonella iron transport xiv Molecular Characterization of Salmonella Enterica Serotype Typhimurium and Enteritidis Isolates from Food Samples in West Bank / Palestine By Omayma Mahmoud Khreishi Supervisor Prof. Ghaleb Adwan Co-Supervisor Dr. Sameh Abuseir Abstract Salmonellae is one of the most frequently isolated foodborne pathogens. It is of major public health concern worldwide. Poultry meat and eggs represent an important source of Salmonellae organism for consumer health. The occurrence of virulence factors among Salmonellae Typhimurium (S. Typhimurium) appears to be lacking in Palestine. This study aimed to evaluate the occurrence of S. Typhimurium and S. Enteritidis using multiplex PCR (mPCR) among isolates collected from the local market, and to assess genetic relationships between strains of S. Typhimurium using virulence factors profiling and fingerprint profiling by RAPD-PCR and repetitive sequence PCR (REP-PCR) using ERIC-PCR and BOXAIR-PCR. The overall occurrence percentage of S. Typhimurium and S. Enteritidis was 54.9% and 0.0%, respectively. Only 13 out of 17 virulence genes were detected in these 28 isolates. The occurrence of the detected genes among these isolates was 100%, 50%, 46.4%, 39.3%, 35.7%, 35.7%, 32.1%, 25%, 25%, 17.6%, 14.3%, 14.3%, 3.6% for invA, sopB, prgH, sitC, pefA, tolC, cdtB, msgA, sifA, iroN, spiA, ipfC and pagC, respectively. The remaining xv virulence genes were absent in all of the isolates. Based on the combination of presence and absence of virulence genes, eight profiles were detected among these isolates, the most common genetic profile was V5 (each 32.1%). In the present study, on the basis of their genetic profile at cut-off point 96%, both ERIC and BOX primers allowed for discrimination into 4 and 6 clusters or clones of 16 S. Typhimurium isolates, respectively. Results of PCR typing methods showed that, strains S83 (chicken wings), S86 (chicken), and S87 (chicken) are clustered together using both ERIC- PCR and BOX-PCR typing methods and they had the same virulotype (V1) and strains S53 (chicken), S73 (chicken), S78 (beef burgher) and S80 (beef burgher) also clustered together by both typing methods and had the same virulotype (V8). The following conclusion with potential implication for the isolation and identification of Salmonellae from food sources were drawn; Contamination of food with Salmonellae especially with S. Typhimurium was high and indicated a bad microbiological quality of food. In addition, the data presented were considered the first attempt to identify a wide range of virulence genes of the S. Typhimurium isolates recovered from different food types in the Palestinian market. This emphasizes the need for rigorous public health and food safety methods to lower the human health hazard and risk associated with Salmonellae infection. 1 Chapter One Introduction 2 Chapter One Introduction 1.1 General background 1.1.1 Salmonella infection (Salmonellosis) Foodborne microorganisms are major pathogens affecting food safety and causing human illness worldwide. These foodborne infections and intoxications result from the consumption of various foodstuffs, mainly animal products contaminated with vegetative pathogens or their toxins. Most of these microorganisms have zoonotic nature, resulting in a significant impact on both human public health and the economic sector (Abebe et al., 2020). According to the World Health Organization (WHO), foodborne diseases are defined as diseases of infectious or toxic nature which are caused by the consumption of food or water (Abebe et al., 2020). Approximately, 250 known causative agents can cause foodborne diseases; these include bacteria, parasites, viruses, prions, toxins, and metals. The symptoms and severity of these foodborne illnesses vary, ranging from mild gastroenteritis to life-threatening neurologic, hepatic, and renal infections (Argaw and Addis, 2015). WHO has reported that 1.8 million childhood deaths were due to acute diarrheal diseases, predominantly in the developing countries, and a high proportion of these cases were due to contamination of food products and potable water (WHO, 2008). Although large numbers of bacterial strains have been identified to be involved in foodborne diseases, 3 many other new emerging strains were also reported (WHO, 2008). In the developed counties, the annual incidence of microbiological foodborne illnesses is estimated to be around 30% of the population (De Guisti et al., 2007). Approximately, 60% of human illnesses are zoonotic diseases that are mainly transmitted to humans from animals and about 75% of new emerging human infectious diseases are transferred from vertebrate animals to humans (Abebe et al., 2020). Bacteria are the causative agents of two- thirds of human foodborne diseases worldwide with a high burden in the developing countries. The most frequent bacterial pathogens that can cause foodborne diseases and deaths in the world including Campylobacter species, Salmonella spp., Staphylococcus aureus (S. aureus), Listeria monocytogenes (L. monocytogenes), and Escherichia coli (E. coli) (Abebe et al., 2020).Animal-based food particularly dairy products (milk, cheese, yogurt, and ice cream), meat (beef, mutton, and pork), poultry and eggs are the main reservoirs by which humans are exposed to the pathogenic bacteria including Salmonella spp. (Abebe et al., 2020). According to the WHO, Salmonella spp. are among the 31 pathogenic agents showing the highest ability of provoking intestinal or systemic disease in humans among diarrheal and/or invasive pathogens, and the third causative agent of death among food-borne diseases (Ferrari et al., 2019). Salmonella are considered one of the most frequently isolated foodborne pathogens worldwide (Abebe et al., 2020; Eng et al., 2015). Foodborne 4 illnesses including salmonellosis have become serious public health problems in many countries in the recent decade (Abuseir et al.,2020). Non-typhoid Salmonella accounts for 93.8 million foodborne infections and 155,000 deaths per year (Eng et al., 2015). In China, 70%-80% of foodborne bacterial outbreaks are attributed to Salmonella infection (Li et al., 2020). There are more than 2,600 serotypes for the genus Salmonella, most of these serotypes have the ability to adapt within different types of animal hosts, including humans. In addition, more than half of Salmonella serotypes belong to Salmonella enterica subsp. enterica, which is associated with the majority of Salmonella infections in humans (Eng et al., 2015). Salmonellosis is an important zoonotic infection seen in all animal species (Seifi et al., 2019). It is considered the second major cause of foodborne disease worldwide, which may lead to severe symptoms and death (Scallan et al., 2011; EFSA and ECDC, 2019; Abuseir et al., 2020; Jeníková et al., 2000). Salmonella serotype Typhimurium (S. Typhimurium) and Salmonella serotype Enteritidis (S. Enteritidis) are considered the most common serotypes that can cause infections in both humans and animals (Kaushik et al., 2014). Clinically, Salmonella spp. have been categorized into 2 groups based on their ability to develop specific pathologies in humans; these are invasive (typhoidal) or noninvasive (non-typhoidal Salmonella) (Okoro et al., 2012). In humans, Salmonella spp. can cause 5 gastroenteritis and enteric fever with bacteremia, resulting from foodborne infection (Eng et al., 2015). Typhoidal serovars (S. Typhi and S. Paratyphi A) do not infect animals but they can cause typhoid fever to humans. So typhoid fever is not considered a zoonotic disease, and it can display several symptoms to humans, such as high fever, diarrhea, vomiting, headaches, and, in extreme cases, death. Therefore, the presence of typhoidal serovars indicates contamination from sick individuals or chronic carriers through poor hygiene management during food and water handling (Ferrari et al., 2019; Abebe et al., 2020). Non-typhoidal Salmonella is considered one of the most important zoonotic bacterial foodborne pathogens. The most common non-typhoidal Salmonella reservoir is the intestinal tract of a large number of domestic and wild animals and a variety of food matrices that can serve as vehicles for transmission of Salmonella spp. to humans through fecal contamination (Ferrari et al., 2019).Animal products are considered the main vehicles of salmonellosis due to the ability of Salmonellae to survive in meat and animal products that are not thoroughly cooked or not properly handled (Akoachere et al., 2009).A wide range of animal-origin food products such as milk, eggs, poultry, beef, and pork are considered the major source for the transmission of non-typhoidal Salmonella. Raw poultry products including eggs are considered a significant reservoir for Salmonella and are often and consistently implicated in human salmonellosis sporadic cases and outbreaks (Abebe et al., 2020). Eggs may be contaminated on the outer surface of the shell and internally (Abuseir et al., 2020). The existence of 6 Salmonella in healthy poultry is considered a major risk factor, that is responsible for transporting the infection from poultry products such as meat and table eggs to humans. Poultry can be infected fundamentally with S. Enteritidis, S. Typhimurium, and S. Heidelberg, these serotypes are distributed worldwide and they are of major economic and public health significance (Abuseir et al., 2020). Past studies have reported that chopping boards, butchers' hands, and knives used for retail chicken processing constitute potential sources for Salmonella cross-contamination (Li et al., 2020). The cross-contamination between meats and personnel and equipment used during the day in the processing of meats due to improper and ineffective cleaning and disinfection particularly with chopping boards, knives, and tables were the risk factors for Salmonella contamination (Dhanalakshmi et al., 2018; Issa et al.,2017). 1.1.2 Nomenclature/Taxonomy The genus of Salmonella contains two species, Salmonella bongori and S. enterica, the latter is further subdivided into six subspecies: S. enterica subsp. enterica, S. enterica subsp. salamae, S. enterica subsp. arizonae, S. enterica subsp. diarizonae, S. enterica subsp. indica, and S. enterica subsp. houtenae, or I, II, IIIa, IIIb, IV, and VI, respectively. Of all the subspecies of Salmonella, the S. enterica subsp. enterica (I) is the most common and is found predominantly associated with most infections in human and worm- blooded animals. On the other hand, the other five subspecies of S. enterica 7 and S. bongori are mainly found in cold-blooded animals and the envi- ronment and rarely in humans (Porwollik et al., 2004; Jajere, 2019). Serotyping is considered the first step to characterize Salmonella isolates although it does not provide sufficient discriminatory subtyping for outbreaks investigation. The conventional method to define a Salmonella serotype is a phenotypic method, based on the standard Kauffman-White- Le Minor scheme. The serotype is based on the agglutination of the bacteria with specific antibodies to identify three groups of surface structures expressed on the bacterial lipopolysaccharide (LPS) somatic (O), flagella (H), and capsular polysaccharide (K) antigens (Ferrari et al., 2019). This provides the antigenic formula of the strain associated with the name and subspecies of the serotype. Until now, there are 46 different serotypes of O antigens and 114 different serotypes of H antigens identified in Salmonella spp., different combinations between these antigens, more than 2600 serotypes were detected (Diep et al., 2019). The surface K antigens are rarely found among the majority of Salmonella serotypes and are heat- sensitive polysaccharides mainly located at the bacterial capsular surface (Jajere, 2019). 1.1.3 Morphology, Bacteriological Culture, and Isolation Procedures The bacterial genus Salmonella is 0.2 to 1.5 by 2 to 5 µm in size, Gram- negative bacillus, facultative anaerobe, non-spore former that belongs to the family Enterobacteriaceae (Okoro et al., 2012; Abed Al-Daym, 2019; Jajere, 2019). Salmonella spp. grow in a pH range of 4 to 9 with the 8 optimum pH between 6.5 and 7.5. Members of this genus are motile by the means of flagella, with the exception of Salmonella Gallinarum (S. Gallinarum) and Salmonella Pullorum (S. Pullorum). Most of the Salmonella serotypes have the ability to produce hydrogen sulfide (H2S) with the exception of a few serotypes such as Salmonella Paratyphi A (S. Paratyphi A), and Salmonella Choleraesuis (S. Choleraesuis). This pathogen is considered a non-fastidious bacterium that can grow in a simple nutrient medium and multiply under various environmental conditions outside the living hosts. Enrichment broths for Salmonella such as Strontium selenite and selenite F broth and selective and differential media such as MacConkey, deoxycholate agar, and Salmonella-Shigella agar are widely used in the laboratory for the culture of the suspected sample. Most of the Salmonella strains are non-lactose fermenting bacteria and this property has been used for the development of many differentials and selective media for the isolation and identification and diagnosis of Salmonella isolates. These media include xylose lysine decarboxylate agar, Salmonella-Shigella agar, brilliant green agar, Hektoen enteric agar, MacConkey’s agar, lysine iron agar, and triple sugar iron agar. Generally, isolation of Salmonella using culture method from different types of food and environment sample needs the multiple steps of pre-enrichment and selective enrichment and growth on the selective and differential media to increase the sensitivity of the detection assays (Abed Al-Daym, 2019; Jajere, 2019). After isolation, identification of the genus Salmonella is carried out by certain biochemical tests. The presumptive biochemical 9 identification of Salmonella then can be confirmed by antigenic analysis of both O and H antigens using polyvalent and specific antisera. Now, various Salmonella serotypes can be identified by polymerase chain reaction (PCR) technique using specific primers (Kaushik et al., 2014; Malorny et al., 2003). Although, isolation of Salmonella by conventional methods, such as growth in a culture medium followed by serotyping is considered the gold standard method for confirmation of Salmonella. However, conventional Salmonella serotyping is laborious and time-consuming. Conventional bacterial culture methods are still used most often to detect and identify Salmonella, these methods require at least several days including selective enrichment and plating followed by biochemical tests. Recently, PCR- based techniques are used effectively for rapid detection of Salmonella serovars using specific primers for a target gene. However, effective surveillance of foodborne pathogens can be achieved through a combination of conventional and PCR-based techniques (Kaushik et al., 2014; Seifi et al., 2019). 1.1.4 Salmonella Typhimurium and Salmonella Enteritidis Salmonella Typhimurium, S. Enteritidis, S. Heidelberg, and S. Newport are the epidemiologically important non-typhoidal Salmonella serotypes, which have been responsible for the majority of human Salmonella disease burden worldwide (Jajere, 2019).In the European Union, the second most frequently bacterial genus involved in gastrointestinal outbreaks in humans is Salmonella and more particularly the species S. Enteritidis and S. 10 Typhimurium (Paniel et al., 2019).S. Enteritidis and S. Typhimurium are prevalent in poultry, and about 95% of cases are caused by the consumption of contaminated food, especially meat and eggs. Poultry are considered one of the most important reservoirs of Salmonella that can transmit these non-typhoidal Salmonella serotypes to humans through the food chain. S. Typhimurium is the most frequently isolated serovar from broilers (Dhanalakshmi et al., 2018). The gastrointestinal tract is considered the main reservoir of Salmonella in mammals (cattle and pigs) and poultry (Paniel et al., 2019). Farm animals carrying these microorganisms barely develop symptoms, making it almost impossible to notice these infections (Paniel et al., 2019).Contaminated poultry products such as meat and eggs continue to play a central role in the spreading the infection of the S. Enteritidis and S. Typhimurium serovars to humans (Ferrari et al., 2019; Wang et al., 2019; Paniel et al., 2019).Epidemiological studies showed that, unlike other non-host adapted Salmonella serotypes such as S. Typhimurium, which is isolated from a variety of food animal sources, S. Enteritidis is predominantly recovered from poultry, suggesting that serovar has likely developed to acquisition a significant tendency to the poultry host (Shah et al., 2017). In addition, S. Typhimurium has also been detected in a wide range of poultry- and animal-derived foods such as retail chickens and pigs from various market types i.e. wet markets and supermarkets and animal products stored at various temperatures i.e. ambient, chilled, and frozen (Li et al., 2020). 11 In 2015, S. Enteritidis was representing 45.7% of all reported serovars in confirmed human cases (EFSA and ECDC, 2016) and accounted for 60.3% of all Salmonella outbreaks and 61.1% human cases in all Salmonella outbreaks in the EU countries (EFSA and ECDC, 2017). The prevalence of S. Enteritidis among Salmonella isolates recovered from different types of samples including food has been reported. The prevalence ranged between 1.3% and 67.8% (Busani et al.,2005; White et al., 2007; Jalali et al., 2008; Moussa et al., 2010; Harsha et al., 2011; Ramya et al., 2012; Hassanin et al., 2014; Magwedere et al., 2015;Thunget al., 2016; El-Tayeb et al., 2017; Amajoud et al., 2017; Proroga et al., 2018; Tegegne, 2019; Elkenany et al., 2019; Siriken et al., 2020). Among more than 2,500 serovars of Salmonella enterica, S. Typhimurium was one of the most frequently isolated worldwide (Medeiros et al., 2015), and it is one of the leading serovars that cause salmonellosis worldwide (Medeiros et al., 2015). A study conducted in India showed that out of 370 samples, 23.7% chicken meat and 7.7% milk samples were found positive for Salmonella based on biochemical reactions. The serotyping of Salmonella isolates showed an incidence of 6.1% of S. Typhimurium, 2.6% of S. Newport, 1.7% of S. Gallinarum, and 0.4% each of S. Enteritidis, S. Infantis, and S. Worthington in broilers; and 2.1% of S. Typhimurium and 1.4% of S. Newportin market milk samples (Kaushik et al., 2014). A study conducted in Egypt showed that the occurrence of S. Enteritidis and S. Typhimurium in raw chicken meat was 2.0% and 3.0%, respectively (Tarabees et al., 2017; Abuseir et al., 2020) 12 A systematic review from Ethiopia revealed that S. Typhimurium (prevalence of 9.4%) was ranked third most common serotype. In the United States, S. Enteritidis and Typhimurium are among the top five most common serotypes reported (Scallan et al., 2011; Al‐Rifai et al., 2019). In Shaanxi, among the 406 Salmonella isolates that belonged to 39 serotypes, S. Typhimurium was the most prevalent. This serotype, one of the most important worldwide, contributes to deaths in young broiler chickens and salmonellosis in humans (Li et al., 2020). Prior studies conducted in Africa and North America have revealed that S. Typhimurium is the most common serotype in cattle and chickens (Li et al., 2020). Also, a study conducted in Shaanxi Province, China in 2020 revealed that S. Typhimurium was the predominant serotype in retail raw chickens, followed by S. Thompson, S. Essen, S. Infantis, S. Riseen, and S. Enteritidis (Li et al., 2020). Between 2001 and 2007 in the USA, Canada, Australia, and New Zealand, S. Typhimurium was the leading isolated serovar. In the same period, S. Typhimurium appeared as the second most isolated serovar in Africa, Asia, Europe, and Latin America, exceeded only by S. Enteritidis (Medeiros et al., 2015). Foodborne outbreaks of salmonellosis have been most frequently associated with S. Enteritidis and S. Typhimurium in India (Dhanalakshmi et al., 2018). The prevalence of S. Typhimurium among Salmonella isolates recovered from different types of samples including food has been reported. The prevalence had a range 3.6%-52.9% (Busani et 13 al., 2005; Moussa et al., 2010; Hassanin et al., 2014; Magwedere et al., 2015; Ammar et al., 2016; Amajoud et al., 2017; El-Tayeb et al., 2017; Proroga et al., 2018; Nouichi et al., 2018; Elkenany et al., 2019; Issa et al.,2017; Al-Dawodi et al.,2012; Habib et al.,2021). 1.1.5 PCR-based typing methods Identifying and typing Salmonella isolates are crucial for diagnosis, treatment, epidemiological surveillance, and tracking the source of an outbreak. Multiple typing methods, including phenotypic and genotypic, are still being used to differentiate microorganisms at the strain level. Bacterial isolates can be characterized based on phenotypic traits, by using biotyping, serotyping, phage typing, antibiotic susceptibility testing, mass spectrometry (MS) and sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) of cellular-extracellular components, and based on nucleic acid, by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), pulsed-field gel electrophoresis (PFGE), random amplified polymorphic DNA (RAPD), amplified fragment length polymorphism (AFLP), ribotyping, multilocus sequence typing and mPCR (Karatuğ et al., 2018). An effective typing method to differentiate Salmonella strains is required for epidemiological studies and to track the source of Salmonella outbreaks. Salmonella enterica is divided into serovars, depending on the O and H antigens, but the serotyping method needs experts and reagents. Using the serotyping method is limited to reference laboratories. This 14 technique has a low power of discrimination and alone is of restricted use as an epidemiological method (Hashemi and Baghbani-Arani, 2015). The application of different molecular techniques for detecting and typing foodborne pathogens in surveillance studies provides reliable epidemiological data for tracing the source of infections in humans. A wide range of different molecular typing methods for identification, speciation, typing, classifying, and/or characterizing foodborne pathogens have been used (Adzitey et al., 2013). These include PFGE, amplified fragment length polymorphism, ribotyping, repetitive DNA sequence-PCR (REP- PCR), multilocus sequence typing (MLST), enterobacterial repetitive intergenic consensus sequences-based PCR (ERIC-PCR), plasmid profiling, and insertion sequence fingerprint (Ross and Heuzenroeder, 2008). The gold standard molecular typing technique is PFGE. However, the disadvantage of using this method is that it does not show the same discriminatory power among different Salmonella serotypes, laborious, and time-consuming (Winokur, 2003).So, an effective, easy, rapid, and reproducible method that has the ability to differentiate among genetically unrelated strains with similar phenotypes, is needed (Wattiau et al., 2011).Several other DNA-based typing methods have been developed for rapid, easy, and simple applicable typing methods that are possible to be available to any laboratory and have high discriminatory power for typing the various Salmonella isolates. These molecular typing methods include 15 RAPD-PCR, BOXAIR, and repetitive extragenic palindromic sequences (REP) and enterobacterial repetitive intergenic consensus (ERIC-PCR), which capture variation on a genomic scale (Hashemi and Baghbani-Arani, 2015). The extensive spread distribution of these repetitive DNA elements in the various microorganism genomes is useful for rapid identification of bacterial species and strains, and analysis of bacterial genomes (Suh and Song, 2006). The combined use of RAPD-fingerprinting and REP- fingerprinting offers an excellent means that can be applied for the discrimination of Salmonella strains (Hashemi and Baghbani-Arani, 2015). In RAPD, genomic DNA is amplified by PCR with short arbitrary primer sequences to generate distinctive patterns of PCR amplicons with various lengths. Regardless of an observed deficiency of reproducibility and sometimes unacceptable sensitivity to reaction conditions, RAPD fingerprinting has been used to study the diversity of organisms' genomes (Khoodoo et al., 2002). The Palindromic Units (PU), which are also called Repetitive Extragenic Palindromes (REP) are present in multiple copies (about 500-1000), dispersed throughout the genomes of many different bacterial species such as the chromosome of Salmonella spp. and Escherichia coli. The REP primers used to identify Repetitive Extragenic Palindromes which are scattered over many bacterial genomes producing amplicons differ in their size depending on the site of the REP sequences. Multiple copies of repeated units of REP sequence have been targeted by this method; these sequences include an inverted repeat of 35-40 nucleotides long, found in clusters in which successive copies (up to six) 16 are arranged in alternate orientation (Martin et al., 1992; Hashemi and Baghbani-Arani, 2015). The ERIC-PCR sequences are 124-127 nucleotide long, highly conserved at nucleotide level include central core inverted repeats and are present in about 150 copies in S. Typhimurium and 30-50 copies in E. coli. The ERIC-PCR sequences, contrary to REP, appear to occur singly (Martin et al., 1992). The ERIC-PCR is a PCR-fingerprinting technique but the primers are not arbitrary because the primers for ERIC-PCR were designed to specific known target sequences. The banding pattern in ERIC-PCR is achieved by amplification of the genomic DNA segments that are located between the ERIC elements or between the ERIC elements and other repetitive DNA sequences (Martin et al., 1992; Zulkifli et al., 2009). The consensus BOX elements are mosaic repetitive sequences, composed of boxA (59-bp) subunit, boxB (45-bp) subunit, and boxC (50-bp) subunit, and is thus 154-bp long. The boxB subunit was present alone as a single copy or as a variable number of direct tandem repeats flanked by boxA and boxC. The DNA sequences of the BOX elements are entirely different from the prokaryotic interspersed repetitive DNA sequences REP and ERIC, although there are similarities to REP and ERIC concerning size, copy number, and potential to form stable stem-loop structures (Martin et al., 1992). The BOXAIR elements are inverted repeat sequences present in a certain bacterial species, including Salmonella (Hashemi and Baghbani- Arani, 2015). 17 The PCR-based typing methods were used to assess genetic relationships between strains of Salmonella spp. (Del Cerro et al., 2002; Weigel et al., 2004; Suh and Song, 2006; Elemfareji and Thong, 2013; Hashemi and Baghbani-Arani, 2015; Poonchareon et al., 2019; Sedeik et al., 2019). 1.1.6 Virulence gene typing Salmonella spp. can establish an infection and cause illness through the expression of several virulence genes that interact with host cells. These virulence genes play very important roles in a broad spectrum of pathogenic mechanisms. These mechanisms including invasion, adhesion, toxin production, systemic infection, antibiotic resistance, fimbrial expression, intracellular survival, and iron and Mg 2+ uptake (Hensel, 2004). The genes prgH, invA, spaN (invJ), spiA, tolC, orgA, sipB, pagC, pefA, msgA, sopB, spvB, lpfC and sifA are expressed to produce certain proteins associated with invasiveness traits, such as cellular invasion/survival and adhesin or pili production. Other genes encode certain proteins thought to be very important to virulence. These factors including iroN and sitC, both these genes are involved in iron acquisition, and cdtB gene is considered as a putative toxin-encoding gene (Skyberg et al., 2006). The functions of these genes are presented in Table 1.1. 18 Table (1.1): Function of virulence factors of S. Typhimurium used in virulence genotyping in this study (Skyberg et al., 2006). Virulence factor Virulence-related function invA, orgA, prgH, tolC, sopB, lpfC, cdtB, pefA Host recognition/invasion spaN Entry into non-phagocytic cells, killing of macrophages sipB Entry into non-phagocytic cells, killing of macrophages iroN, sitC Iron acquisition pagC, msgA, spiA Survival within macrophage sifA Filamentous structure formation spvB Growth within-host There are several studies showed that Salmonella strains contain a wide range of virulence factors associated with pathogenesis (Skyberg et al., 2006; Huehn et al., 2010; Elemfareji and Thong, 2013; Borges et al., 2013; Mezal et al.,2014; Rowlands et al., 2014; Gharieb et al., 2015; Tarabees et al., 2017; Srisanga et al., 2017; Thung et al., 2018; Liaquat et al.,2018; Elkenany et al., 2019). 1.2 Aims of the Study The prevalence and molecular characterization of S. Typhimurium and S. Enteritidis isolates recovered from food samples have not been examined previously in the West Bank-Palestine. The current study aimed to: 1. characterize and document the prevalence and distribution of S. Typhimurium and S. Enteritidis isolates in food samples. 2. S. Typhimurium isolates recovered from different types of food were fingerprinted by RAPD-PCR and REP-PCR, using ERIC-PCR and 19 BOXAIR-PCR to assess genetic relationships between strains of S. Typhimurium. 3. Also, the pathogenic potential of recovered S. Typhimurium in the present study was assessed using virulotyping PCR assay, targeting 17 virulence gene sequences. To the best of our knowledge, this is the first study that determines the occurrence of S. Typhimurium and the distribution of virulence genes in isolates recovered from food samples in Palestine. 20 Chapter Two Materials and Methods 21 Chapter Two Materials and Methods 2.1 Samples collection A total of 51 Salmonella isolates were recovered from different types of food samples, which were collected from the local market in different governorates and areas in the West Bank, Palestine during 2019. These samples were Chicken (18), Chicken breast (1), Kebab (1), Turkey (2), Cheese (1), Beef burger (11), Chicken wings (4), Hummus (1), Turkey meat (1), Boneless chicken (1), Parsley (1), Tahini (4), Restaurant's salad (1), Halawa (1), Meat (1), Fillet-fish (1) and Beef meat (1). All Salmonella isolates were collected and identified by Dr. Amjad Hussein (Chemical, Biological and Drugs Analysis Center, An-Najah National University, Palestine). Identification of these isolates was done by conventional methods using enrichment, selective and differential media, Gram staining, biochemical tests (Motility test (SIM), and Triple Sugar Iron test (TSI)). All cultures that were negative for Lactose/Sucrose, positive for Glucose, produce H2S, and motile were kept for serological confirmation. The serological confirmation used is genus-specific, to confirm the Salmonella isolates using specific antisera (Biorad). The agglutination test was carried out on a glass slide. One drop from specific antiserum was mixed with one drop from suspected Salmonella broth culture or 0.9% sterile saline suspected Salmonella suspension. Any agglutination after two minutes for both the somatic “O” and flagella “H” antisera was considered a positive reaction for the tested Salmonella spp. These isolates are stored in the 22 Chemical, Biological, and Drugs Analysis Center (Nablus, Palestine) at - 70ºC. 2.2 DNA isolation and PCR technique 2.2.1 DNA extraction The DNA genome of Salmonella spp. was prepared for PCR according to the method described previously (Adwan et al., 2013). Briefly, cells were scraped off an overnight Mueller Hinton agar plate, re-suspended in 800 µl of 1X Tris-EDTA buffer (10 mM Tris-HCl, 1 mM EDTA [pH 8]), centrifuged for 5 minutes at 14,000 x g; after that, the supernatant was discarded. Then the pellet was re-suspended in 400 µl of sterile distilled water, and boiled for 10-15 min. Then, the cells were incubated on ice for 10 min. The debris was pelleted by centrifugation at 14,000 x g for 5 min, and sample supernatant was transferred into a new Eppendorf tube. The concentration of the DNA sample was determined using a nanodrop spectrophotometer (Genova Nano, Jenway), and the DNA samples were stored at -20ºC for further analysis. 2.2.2 Salmonellae spp. confirmation and S. Typhimurium and S. Enteritidis identification by multiplex PCR (mPCR) For mPCR detection, three primer pairs were used in this study. These primer pairs were used to identify specific target genes, included invA for Salmonella spp. identification, STMO159 (a putative restriction endonuclease) for S. Typhimurium identification, and SEN1383 (a 23 hypothetical protein) for S. Enteritidis identification. Target gene, primer sequence, and amplicon size for these primer pairs are presented in Table 2.1. The mPCR reaction mix was carried according to the method described previously (Ranjbar et al., 2017) with some modifications. A final volume of 25 µl mPCR reaction mix was performed as follows: 12.5 µl of PCR premix (ReadyMix TM Taq PCR Reaction Mix with MgCl2, Sigma), 0.3µM of each primer and 3 µl (50-70 ng) of target DNA template. DNA amplification was carried out using a thermal cycler (Mastercycler personal, Eppendorf, Germany) according to the following conditions: initial denaturation at 94ºC for 3 min; followed by 30 cycles of denaturation at 94ºC for 1 min, annealing at 57ºC for 1 min and extension at 72ºC for 1 min. Then, these cycles were followed by a single final extension step at 72ºC for 5 min. The PCR amplicons were then detected by electrophoresis through 1.5% agarose gels to determine the size of amplicons after staining with a final concentration of 0.5µg/ml of ethidium bromide dye. The sizes of the PCR products were determined by comparing them with a 100-bp DNA ladder. Live attenuated vaccine for S. Typhimurium and S. Enteritidis (Biovac Company) was used as positive control and E. coli ATCC25922 strain was used as a negative control. 24 Table (2.1): Oligonucleotide primers used for Salmonella spp. confirmation, S. Typhimurium, and S. Enteritidis detection. Target gene Primer Sequence 5'→3′ Amplicon size (bp) Reference invA- secretory protein (Salmonella spp.) invA F: GTATTGTTGATTAATGA GATCCG invA R: ATATTACGCACGGAAA CACGTT 404 Ranjbar et al., 2017 SEN1383-a hypothetical protein (S. Enteritidis) SEN1383 F: TGTGTTTTATCTGATGC AAGAGG SEN1383 R: TGAACTACGTTCGTTCT TCTGG′ 304 Ranjbar et al., 2017 STM0159–a putative restriction endonuclease (S. Typhimurium) STM0159 F: ATG ATG CCT TTT GCT GCT TT' STM0159 R: TCC CAG CTC ATC CAA AAA 224 Ranjbar et al., 2017 enterobacterial repetitive intergenic consensus ERIC1: ATG TAA GCT CCT GGG GAT TCAC ERIC2: AAG TAA GTG ACTGGG GTG AGC G - Versalovicet al. 1991 interspersed repetitive DNA sequence (BOX) BOXAIR CTACGGCAAGGCGACG CTGACG - Dombek et al. 2000 random amplification of polymorphic DNA (RAPD) OPP-16CCA AGC TGC C - Albufera et al. 2009 2.2.3 Molecular typing of S. Typhimurium by ERIC- PCR, and BOXAIR-PCR Salmonella Typhimurium isolates recovered from different food samples were fingerprinted by ERIC-PCR and BOXAIR-PCR using ERIC-PCR primers and interspersed repetitive DNA sequence (BOX) primers, respectively, to assess genetic relationships between the strains of S. 25 Typhimurium from these different sources. The primers for ERIC-PCR and BOXAIR-PCR are presented in Table 2.1. Each PCR reaction mix (25 µl) was composed of 10 mM PCR buffer pH8.3; 3 mM MgCl2; 0.4 mM of each dNTP; 0.8 µM of each primer; 1.5U of Taq DNA polymerase and 3 µl of DNA template. The DNA amplification for ERIC-PCR was carried out using a thermal cycler (Mastercycler personal, Eppendorf, Germany) according to the following conditions: initial denaturation for 2 min at 94ºC, followed by 40 cycles of denaturation at 94ºC for 50 s, annealing at 50ºCfor 40 s and extension at 72ºC for 1 min. Then, these cycles were followed with a final extension step at 72ºC for 5 min. For BOXAIR-PCR, the thermal conditions were: initial denaturation at 94°C for 2 min, followed by 30 cycles of denaturation at 94°C for 50 s, annealing at 50°C for 40 s and extension at 72°C for 2 min. After that, these cycles were followed with a final extension step at 72°C for 5 min. The PCR products were analyzed by electrophoresis on1.5% agarose gels. The bands in gel images were analyzed using a binary scoring system, which recorded the absence and presence of bands as 0 and 1, respectively. The binary matrix was analyzed by the unweighted pair group method for arithmetic averages (UPGMA), using SPSS statistical software version 20 (IBM). The clusters of the fingerprints in the constructed dendrogram were described at a 96% similarity level. The number of different bands in each fingerprint was considered for comparison between S. Typhimurium strains as previously described (Adwan et al., 2016; Adwan et al., 2016; Adwan et al., 2016; Adwan et al., 2018), based on the following criteria: identical 26 clones (no different bands), "closely related clones" (have 1 different band),"possibility different clones" (have two different bands), "different clones" (have three or more different bands). 2.2.4 Molecular typing of S. Typhimurium by RAPD-PCR Salmonella Typhimurium isolates recovered from different food samples were fingerprinted by RAPD-PCR using the RAPD primer OPP-16 to assess genetic relationships between the strains of S. Typhimurium from these sources. The primer sequence for RAPD-PCR is presented in Table 2.1. RAPD-PCR was carried as described previously with some modification (Hashemi and Baghbani-arani, 2015). Each PCR reaction mix was carried out as well as ERIC- PCR mix and BOXAIR-PCR mix. DNA amplification for RAPD-PCR was carried out using a thermal cycler (Mastercycler personal, Eppendorf, Germany) according to the following thermal conditions: initial denaturation for 3 min at 94ºC, followed by 40 cycles of denaturation at 94ºC for 1 min, annealing at 35ºC for 1 min and extension at 72ºC for 2 min. Then, these cycles were followed with a final extension step at 72ºC for 5 min. The PCR products were analyzed as well as the ERIC- PCR, and BOXAIR-PCR. 2.2.5 Virulotyping of S. Typhimurium isolates by multiplex PCR (mPCR) Three mPCR reactions were used to amplify the seventeen virulence genes. Pools of reaction, target gene, primer sequence, amplicon size for these primers are presented in Table 2.2. 27 The mPCR was carried as described previously with some modification (Skyberg et al., 2006). Each PCR reaction mix (25 µl) was composed of 10 mM PCR buffer pH 8.3; 6 mM MgCl2; 0.3 mM of each dNTP; 0.3µM of each primer; 1.5U of Taq DNA polymerase, 3% DMSO, and 3 µl of target DNA template. DNA amplification for mPCR was carried out using a thermal cycler (Mastercycler personal, Eppendorf, Germany) according to the following thermal conditions: initial denaturation for 3 min at 94ºC, followed by 25 cycles of denaturation at 94ºC for 40 s, annealing at 62ºC for 40 s and extension at 72ºC for 2 min. After that, these cycles were followed with a final extension step at 72ºC for 5 min. The PCR products were then detected by electrophoresis through 1.5% agarose gels to determine the size of amplified fragments after staining with a final concentration of 0.5 µg/ml of ethidium bromide dye. The sizes of the amplicons of these genes were determined by comparing them with a 100- bp DNA ladder. 28 Table (2.2): Virulence gene primers used in this study (Skyberg et al., 2006). Target gene Primer sequence 5'→3′ Amplicon size pool spvB spvB F: CTA TCA GCC CCG CAC GGA GAG CAG TTT TTA spvB R: GGA GGA GGC GGT GGC GGT GGC ATC ATA 717 1 spiA spiA F: CCAGGGGTCGTTAGTGTATTGCGTG AGATG spiA R: CGCGTAACAAAGAACCCGTAGTGA TGGATT 550 1 pagC pagC F: CGCCTTTTCCGTGGGGTATGC pagC R: GAAGCCGTTTATTTTTGTAGAGGAG ATGTT 454 1 cdtB cdtB F: ACAACTGTCGCATCTCGCCCCGTCA TT cdtB R: CAATTTGCGTGGGTTCTGTAGGTGC GAGT 268 1 msgA msgA F: GCC AGG CGC ACG CGA AAT CAT CC msgA R: GCG ACC AGC CAC ATA TCA GCC TCT TCA AAC 189 1 invA invA F: CTG GCG GTG GGT TTT GTT GTC TTC TCT ATT invA R: GTT TCT CCC CCT CTT CAT GCG TTA CCC 1070 2 sipB sipB F: GGA CGC CGC CCG GGA AAA ACT CTC sipB R: ACA CTC CCG TCG CCG CCT TCA CAA 875 2 prgH prgH F: GCC CGA GCA GCC TGA GAA GTT AGA AA prgH R: TGA AAT GAG CGC CCC TTG AGC CAG TC 756 2 29 Target gene Primer sequence 5'→3′ Amplicon size pool spaN Span F: AAA AGC CGT GGA ATC CGT TAG TGA AGT span R: CAG CGC TGG GGA TTA CCG TTT TG 504 2 orgA orgA F: TTT TTG GCA ATG CAT CAG GGA ACA orgA R: GGC GAA AGC GGG GAC GGT ATT 255 2 tolC tolC F: TAC CCA GGC GCA AAA AGA GGC TAT C tolC R: CCG CGT TAT CCA GGT TGT TGC 161 2 iroN Iron F: ACT GGC ACG GCT CGC TGT CGC TCT AT iron R: CGC TTT ACC GCC GTT CTG CCA CTG C 1205 3 sitC sitC F: CAG TAT ATG CTC AAC GCG ATG TGG GTC TCC sitC R: CGG GGC GAA AAT AAA GGC TGT GAT GAA C 768 3 lpfC lpfC F: GCC CCG CCT GAA GCC TGT GTT GC lpfC R: AGG TCG CCG CTG TTT GAG GTT GGA TA 641 3 sifA sifA F: TTT GCC GAA CGC GCC CCC ACA CG sifA R: GTT GCC TTT TCT TGC GCT TTC CAC CCA TC 449 3 sopB sopB F: CGG ACC GGC CAG CAA CAA AAC AAG AAGAAG sopB R: TAG TGA TGC CCG TTA TGC GTG AGT GTA TT 220 3 pefA pefA F: GCG CCG CTC AGC CGA ACC AG pefA R: GCA GCA GAA GCC CAG GAA ACA GTG 157 3 30 Chapter Three Results 31 Chapter Three Results 3.1 Salmonellae spp. confirmation and S. Typhimurium and S. Enteritidis detection A total of 51 Salmonella isolates were recovered from different types of food samples, which were collected from local markets in different areas in the West Bank, Palestine during 2019. These isolates were identified using conventional methods and specific antisera to a genus level by Dr. Amjad Hussein (Chemical, Biological and Drugs Analysis Center, An-Najah National University, Palestine). All these Salmonella isolates were subjected to mPCR using specific primers to confirm that these isolates belonged to a Salmonella genus and to determine the occurrence of S. Typhimurium and S. Enteritidis serotypes among these isolates. As expected, PCR confirmation of conventional and serological methods positive strains was documented by the appearance of the amplified DNA fragment of 404-bp for the invA gene, a target for Salmonella genus, in all 51 (100%) Salmonella isolates examined. In addition, 28 (54.9%) isolates were S. Typhimurium serotype and produced amplified DNA fragment of 224-bp forSTMO159 gene (a putative restriction endonuclease), while amplified DNA fragment of 304-bp for SEN1383 gene (a hypothetical protein) for S. Enteritidis serotype was not detected in all Salmonella isolates. Multiplex PCR profile specific for genes responsible for detection Salmonella genus (invA gene; 404-bp), S. Typhimurium serotype (STMO159, a putative restriction endonuclease; 224-bp), and S. Enteritidis serotype (SEN1383, a hypothetical protein; Occurrence of S. Typhimurium from different types of food samples is presented in Table Figure (3.1): Multiplex PCR profile specific for genes responsible for detection isolates of Salmonella (STMO159, a putative restriction endonuclease; (SEN1383, a hypothetical protein; Lanes: L represents 100 serotype: lane 3 represent control; Lanes1 and 2 Enteritidis serotypes (Bio 32 , a hypothetical protein; 304-bp) is shown in Figure yphimurium serotype among Salmonella from different types of food samples is presented in Table 3.1 Multiplex PCR profile specific for genes responsible for detection Salmonella genus, (invA gene; 404-bp) S. Typhimurium , a putative restriction endonuclease; 224-bp) and , a hypothetical protein; 304-bp). 100 bp ladder; lanes 4, 5, 6, 7, and 8represent represents Salmonella genus. lane 9 represents E. coli represent live attenuated vaccine for S. Typhimurium and ovac Company) as a positive control, respectively. bp) is shown in Figure 3.1. Salmonella spp. isolated 3.1 Multiplex PCR profile specific for genes responsible for detection yphimurium serotype and S. Enteritidis represent S. Typhimurium E. coli as a negative yphimurium and S. vac Company) as a positive control, respectively. 33 Table (3.1): Occurrence of S. Typhimurium serotype among Salmonella spp. isolated from different types of food samples. Source Salmonella spp. n (%) S. Typhimurium n (%) * Chicken 18(35.3%) 9 (50%) Beef Burger 11(21.5%) 9 (81.8%) Beef Meat 1(1.96%) 0 (0.0%) Chicken wings 4(7.84%) 4 (100%) Chicken Breast 1(1.96%) 1 (100%) Boneless Chicken 1(1.96%) 0 (0.0%) Kebab 1(1.96%) 1 (100%) Meat 1(1.96%) 0 (0.0%) Turkey Meat 1(1.96%) 1 (100%) Turkey 2(3.92%) 1 (100%) Fillet Fish 1(1.96%) 1 (100%) Parsley 1(1.96%) 0 (0.0%) Tahinia 4(7.84%) 0 (0.0%) Hummus restaurants 1(1.96%) 1 (100%) Halawa 1(1.96%) 0 (0.0%) Cheese 1(1.96%) 0 (0.0%) Restaurant Salad 1(1.96%) 0 (0.0%) Total 51 (100%) 28 (54.9%) *: number of isolates 3.2 Virulotyping of S. Typhimurium serotype isolates by multiplex PCR (mPCR) PCR targeting 17 virulence genes (invA, orgA, prgH, tolC, sopB, lpfC, cdtB, pefA, spaN, sipB, iroN, sitC, pagC, msgA, spiA, sifA, spvB) were conducted in the current study to characterize28S. Typhimurium isolates virulence. Only 13 genes were detected in these 28 S. Typhimurium isolates. The occurrence of the detected genes among these isolates was 100%,50%,46.4%, 39.3%, 35.7%, 35.7%, 32.1%, 25%,25%, 17.6%, 14.3%, 14.3%, 3.6% for invA,sopB,prgH,sitC,pefA,tolC, cdtB, msgA, sifA, iroN, spiA,ipfC and pagC, respectively. The remaining virulence genes were absent in all the of presence and absence of virulence genes, these isolates, the most common genetic profile invA gene which is genus 3.2 and Table 3.2 showed d this study. Figure (3.2): Multiplex PCR profiles specific for factors. Figure A: spiA gene (550 bp). Figure B: invA gene ( gene (1205-bp), sitC gene ( bp) and pefA gene (157-bp). 34 were absent in all the S. Typhimurium isolates. Based on of presence and absence of virulence genes, 8 profiles were detected among the most common genetic profilewasV5 (each gene which is genus-specific gene was detected in all isolates showed data about virulence gene profiles Multiplex PCR profiles specific for S. Typhimurium virulence 550-bp), pagC gene (454-bp), cdtB gene (268-bp) and gene (1070-bp), prgH gene (756-bp), tolC gene (161- gene (768-bp), ipfC gene (641-bp), sifA gene (449-bp), bp). the combination profiles were detected among each 32.1%). The specific gene was detected in all isolates. Figure profiles detected in yphimurium virulence bp) and msgA gene (189- -bp). Figure C: iroN bp), sopB gene (220- 35 Table (3.2): Virulence gene profile of 28S. Typhimurium isolated from different types of food samples Virulotypes (V) Gene combinations No. of Strains (%) V1 invA, spiA,cdtB, iroN, ipfC, sifA, pefA 4 (14.3) V2 invA, cdtB, prgH,tolC, sitC, sopB, pefA 2 (7.1) V3 invA, pagC, tolC, iroN, sopB, pefA 1 (3.6) V4 invA, msgA, tolC, sitC, sifA 5 (17.9) V5 invA, prgH, sopB, 9 (32.1) V6 invA, cdtB,sopB, pefA 3 (10.7) V7 invA, prgH, sitC, sopB, 2 (7.1) V8 invA, msgA, tolC, sitC, sifA, 2 (7.1) 3.3 Genotyping of S. Typhimurium serotype by PCR-based methods In the present study, ERIC and BOX primers allowed for discrimination into 4 and 6 clusters or clones of 16 S. Typhimurium serotype isolates, respectively, based on their genetic profile at cut-off point 96%. RAPD- PCR using the RAPD primer OPP-16 did not allow for discrimination between S. Typhimurium isolates. The RAPD OPP-16primer did not produce any amplified fragments during PCR amplification. According to the ERIC-PCR profile, strains of cluster C1 and C2, C3 and C4, and C3 and C2 are closely related clones. Strains of C4 and C1, and C3 and C1 are different clones, while strains of C4 and C2 are possibly different clones. ERIC-PCR DNA fingerprint pattern, dendrogram, and the relationship between the clones of 16 S. Typhimurium strains recovered from different food samples are presented in (Figure 3.3, Figure 3.4, and Table 3.3). Figure (3.3): DNA fingerprint patterns Typhimurium serotype isolates electrophoresed in a 1.5% Lanes L:100-bp ladder Figure 3.4 Dendrogram of UPGMA method using Average linkage (between groups)/Squared Euclidean Distance by SPSS software version derived from analysis of the ERIC 36 DNA fingerprint patterns generated by ERIC-PCR typing of serotype isolates recovered from different 1.5% agarose. bp ladder; other lanes referring to S. Typhimurium Dendrogram of 16 S. Typhimurium serotype isolates UPGMA method using Average linkage (between groups)/Squared Euclidean Distance by SPSS software version 20ز derived from analysis of the ERIC-PCR-profiles at a 96% similarity level. C: Cluster PCR typing of 16 S. different food samples yphimurium serotype isolates. serotype isolates based on the UPGMA method using Average linkage (between groups)/Squared Euclidean similarity level. C: Cluster. 37 Table (3.3): Relationship between the clones or the clusters depending on the number of different bands based on ERIC-PCR profile of 16 S. Typhimurium serotype isolates. Cluster or clone Cluster relationship C1 C2 C3 C4 C1 1 2 4 4 C2 1 2 3 C3 1 2 C4 1 1. identical clones, 2. closely related clones, 3. possibility different clones, 4. different clones. C: cluster or clone According to the BOX-PCR profile, Strains of cluster C1 and C2, C3 and C4, C4 and C5, and C4 and C6 are closely related clones. Strains of cluster C2 and C3, C5 and C2, C5 and C3, C6 and C2, C6 and C3, and C6 and C5are possibility different clones, while strains of C3 and C1, C4 and C1, C4 and C2, C5 and C1, and C6 and C1 are different clones. BOX-PCR DNA fingerprint pattern, dendrogram, and the relationship between the clusters or clones of 16 S. Typhimurium serotype isolates recovered from different food samples are presented in (Figure 3.5, Figure 3.6, and Table 3.4). Figure (3.5): DNA fingerprint patterns generated by BOX Typhimurium serotype isolates electrophoresed in a 1.5% Lanes L: 100-bp ladder; other lanes referring to Figure (3.6) Dendrogram of UPGMA method using Average linkage (between groups)/Squared Euclidean Distance by SPSS software version derived from analysis of the BOX Cluster. 38 DNA fingerprint patterns generated by BOX-PCR typing of Typhimurium serotype isolates recovered from different food samples 1.5% agarose. bp ladder; other lanes referring to S. Typhimurium Dendrogram of 16 S. Typhimurium serotype isolates UPGMA method using Average linkage (between groups)/Squared Euclidean Distance by SPSS software version 20. derived from analysis of the BOX-PCR-profiles at a 96% similarity level. C: PCR typing of 16 S. recovered from different food samples yphimurium isolates. serotype isolates based on the UPGMA method using Average linkage (between groups)/Squared Euclidean similarity level. C: 39 Table (3.4) Relationship between the clones or the clusters depending on the number of different bands based on BOX-PCR profile of 16 S. Typhimurium serotype isolates. Cluster or clone Cluster relationship C1 C2 C3 C4 C5 C6 C1 1 2 4 4 4 4 C2 1 3 4 3 3 C3 1 2 3 3 C4 1 2 2 C5 1 3 C6 1 1. identical clones, 2. closely related clones, 3. possibility different clones, 4. different clones. C: cluster or clone Results of PCR typing methods showed that strain S83 (chicken wings) and strains S86and S87 (chicken) are clustered together using both ERIC-PCR and BOX-PCR typing methods and they had the same virulotype pattern (V1). However, strainsS78 and S80 (beef burgher) and strains S53 and S73 (chicken) also clustered together by both typing methods and had the same virulotype pattern (V4). 40 Chapter Four Discussion 41 Chapter Four Discussion Salmonellosis remains a significant public health problem causing food poisoning in humans. Poultry, its products and eggs, represent an important source of Salmonella organism for consumer health (Jinu et al., 2014). Most infections result from the ingestion of foods of animal origin contaminated with Salmonella species such as chicken, eggs, beef, shellfish, and milk (Ahmed et al., 2014). Salmonella enterica is highly diverse, containing over 2,500 different serovars. The representative serovars from this species are the most commonly isolated serovars during outbreaks of foodborne salmonellosis, including S. Enteritidis, S. Typhimurium, S. Virchow, and S. Infantis (Tarabees et al., 2017). S. Enteritidis and S. Typhimurium are the most predominant isolated organisms in most Salmonella cases associated with the consumption of contaminated poultry, pork, and beef products. Contamination with Salmonella in poultry products can occur at multiple steps along the food chain, including production, processing, distribution, retail marketing, handling, and preparation (Tarabees et al., 2017). Monitoring of Salmonella spp. along the food chain is conducted during pre-harvest (farm animals and their feed), processing (cutting plants and slaughterhouses), and post-harvest (retail and catering) stages (EFSA, 2018). Kotova et al. (1988) observed that humans develop the Salmonella carrier state after acute salmonellosis, which is the result of occupational exposure to poultry (6.1% -8.8%). To the best of our knowledge, this work is the first to 42 molecularly characterize S. Typhimurium strains in the West Bank, Palestine, and assessing their distribution of virulence genes of the recovered Salmonella isolates. The present preliminary screening study was conducted to shed light on the occurrence of S. Typhimurium and S. Enteritidis, genotyping the detected isolates using PCR-based methods, and the virulence genotyping of these isolates that were recovered from different types of food. Results of this study were that all the isolates identified as Salmonella spp. by conventional and specific antisera to a genus level had had invA gene, which is a target for Salmonella genus. Detection of the invA gene with specific PCR primers is a rapid, sensitive, and specific method for the identification of Salmonella at the genus level in a variety of food samples. The current study supported the ability of specific primer sets for detection invA gene can confirm the isolates as Salmonella spp. The protein encoded by the invA gene is essential for the invasion of host epithelial cells (Darwin and Miller, 1999). As anticipated, PCR confirmation of Salmonella isolates diagnosed by conventional methods and specific antisera was documented by the appearance of amplified DNA fragments of 404-bp length for the invA gene in all 51 (100%) Salmonella strains tested, regardless of the serotype or the type of food sample. Several studies had also proven the effective detection of all Salmonella isolates using specific primers for the invA gene (Malorny et al., 2003; Helmy et al., 2009; Moussa et al., 2010; Shanmugasamy et al., 2011; Borges et al., 2013; Ammar et al., 2016; Ranjbar et al.,2017; Srisanga et al., 2017; 43 Proroga et al., 2018), which was used as a target gene in PCR assays and a confirmatory test for Salmonella detection (Malorny et al., 2003; Helmy et al., 2009; Shanmugasamy et al., 2011;Proroga et al., 2018).In contrary to our result of the current study, a published report showed that the invA gene was detected in 96.43% of Salmonella isolates (Nouichi et al., 2018). Identifying Salmonella serovars using serotyping method is highly expensive and time-consuming. For these reasons, the use of other techniques such as PCR techniques for recognition and identification of S. Typhimurium and S. Enteritidis as described in this study is an alternative method to the conventional techniques. In the current study, PCR technique used for the identification of S. Typhimurium was very specific and produced an amplified DNA fragment of 224-bp for STMO159 gene (a putative restriction endonuclease), while amplified DNA fragment of 304- bp for SEN1383 gene (a hypothetical protein) for S. Enteritidis. Results of this research study showed that the occurrence of S. Typhimurium and S. Enteritidis was 54.9% and 0%, respectively. These results indicated the health hazard of these food types as a source of Salmonella foodborne pathogens. A study conducted in Egypt showed that S. Enteritidis (33.3%) was the most common among Salmonella isolates recovered from bulk milk, raw market milk, followed by S. Typhimurium (25.9%), S. Heidelberg (14.8%), and others (El-Baz et al., 2017).In another study carried out in the same previous country, 7 Salmonella serovars were isolated from freshly dead 44 and diseased broiler chickens, in which the most common serovars identified were S. Typhimurium (52.9%), followed by S. Enteritidis and S. Arizona, each had occurrence rate 11.8%. Other Salmonella serotypes included S. Kentucky, S. Montevideo, S. Birkenhead, and S. Virchow were 23.5% (Ammar et al., 2016). Another Previous study carried out in Egypt showed that 50% of Salmonella isolates recovered from poultry meat was S. Typhimurium, while S. Rubislaw, S. Kiel, and S. Derby (10% each) and 20% were Untypable Salmonella spp. (Gharieb et al., 2015). A study carried out by Hassanin et al., (2014), showed the occurrence of S. Enteritidis and S. Typhimurium recovered from ready-to-eat meat samples and ready-to-eat chicken samples were 37.5% and 29.2%, respectively (Hassanin et al., 2014). Rabie et al., (2012) found that the Salmonella isolates collected from diarrheic broiler chickens, raw frozen chickens' meat, and diarrheic patients with food poisoning signs, were serologically identified as 58.3% and 41.6% for S. Enteritidis and S. Typhimurium respectively (Rabie et al., 2012). In a new study carried out in Saudi Arabia, Salmonella strains recovered from clinical and environmental samples showed that the S. Enteritidis serotype had the highest prevalence (39.4%), followed by S. Paratyphi (21.2%), S. Typhimurium (15.2%), S. Typhi and S. Arizona (12.1%) (El-Tayeb et al., 2017). Another study carried out in Saudi Arabia showed that the occurrence of S. Enteritidis and S. Typhimurium was the most common serotypes recovered among the Salmonella serotypes 55.6% and 22.2%, respectively, isolated from frozen chickens and chicken cuts (Moussa et al., 2010). In Morocco, it has been 45 shown that S. Kentucky was the most common serotype (22.9%) isolated from food products, while the occurrence of S. Typhimurium and S. Enteritidis was lower than the other serovars, they were 6.2% and 4.2%, respectively (Amajoud et al., 2017).In Algeria, a recent study showed that the most predominant Salmonella isolates collected from carcasses and feces of cattle and sheep was S. Muenster (39.3%), while S. Typhimurium was (3.6%) (Nouichi et al., 2018), even this serotype is scarcely identified from humans, foods, or animals (Van Cauteren et al., 2009). According to the European Food Safety Authority, it was mentioned that the most prevalent serovar continues to be Salmonella Enteritidis (SE) and Salmonella Typhimurium (ST) and monophasic S. Typhimurium (1,4,[5],12: i:-), these serotypes representing 49.1%, 13.4%, and 8%, respectively, of all reported serovars confirmed in human cases (EFSA and ECDC, 2018). A study conducted in Italy, France and Switzerland from 2000 to 2011, showed that the occurrence of S. Enteritidis and S. Infantis reduced significantly, S. Typhimurium existed stable, while other serovars, including S. (4,[5],12:i:-) and S. Napoli raised significantly (Graziani et al., 2013). In Italy, A series of studies has been carried out (Busani et al., 2005; Capuano et al., 2013; Proroga et al., 2018). The most common S. enterica serotypes of human origin were S. Typhimurium (32.7%), S. Enteritidis (26.7%), the monophasic variant of S. Typhimurium (S. 4,[5],12: i:-) (24.7%), and S. Napoli (4.7%) (Proroga et al., 2018). A study carried out by Capuano et al., (2013) in Italy showed that the prevalence of S. 4,[5],12: i: -, S. Enteritidis and S. Typhimurium, in food samples was 37.2%, 32.5%, 46 and 30.2%, respectively (Capuano et al., 2013). Another study in the same country reported that S. Typhimurium was the most common serotype in foods of animal origin (18.8%), followed by S. Derby and S. Enteritidis for 10.5% and 9.9%, respectively (Busani et al., 2005). In addition, Anumolu and Lakkineni (2012) revealed a wide variation in the detection of Salmonella Typhimurium in poultry samples, out of 50 chicken samples, 3 samples were positive for Salmonella Typhimurium. Nearly similar results were also obtained by Shaltout et al., (2019), El-Kader et al., (2015), and Rao et al., (1977), where they could isolate S. Typhi, S. Typhimurium, and S. Enteritidis from different meat samples with a percentage of 3.3 % for each strain. In Mexico, S. Typhimurium was the most common serotype (23.9%) isolated from vegetables, while S. Enteritidis was 2.81% (Quiroz-Santiago et al., 2009). In Malaysia, the occurrence of S. Enteritidis and S. Typhimurium among Salmonella isolates recovered from beef meat samples was 16.7% and 11.1%, respectively (Thung et al., 2018). In South Africa, 2012-2014; Salmonella strains recovered from food-producing animals, meat, animal feed, the environment, and other non-human sources, showed that the prevalence of S. Enteritidis and S. Typhimurium was21.5% and 4.0%, respectively (Magwedere et al., 2015). The previous studies showed that Salmonella serovars vary geographically, at the global level. S. Enteritidis and S. Typhimurium were considered the most common serovars recorded and clinically significant (EFSA and 47 ECDC, 2015; Ammar et al., 2016). The differences in occurrence rates of Salmonella serotypes may be affected by different factors such as differences in the sampling method, sample types, Salmonella detection protocol, geographic region, and the housing and husbandry conditions (Busani et al., 2005; Nouichi et al., 2018). Different molecular techniques have been used to distinguish the strains of Salmonella isolates including PFGE, ERIC-PCR, RAPD-PCR, Single Strand Conformation Polymorphism (SSCP), hybridization, and ribotyping-PCR. Results of PCR typing methods showed that strains S83 (chicken wings), S86 (chicken), and S87 (chicken) are clustered together using both ERIC-PCR and BOX-PCR typing methods and they had the same virulotype (V1), and strains S53 (chicken), S73 (chicken), S78 (beef burgher) and S80 (beef burgher) also clustered together by both typing methods and had the same virulotype (V4). Results showed that using more than one molecular method is useful in an epidemiological study of S. Typhimurium. In the present study, both ERIC and BOX primers allowed for discrimination into 4 and 6 clusters or clones of 16 S. Typhimurium isolates, respectively, based on their genetic profile at cut-off point 96%. RAPD-PCR using the RAPD primer OPP-16 did not allow for discrimination between S. Typhimurium isolates. On the other hand, a study conducted in Colombia (Lozano-Villegas et al., 2019) revealed that genotyping of Salmonella spp. using RAPD primers allowed the typing of 34 of 49 strains of Salmonella spp. The best discriminatory index was 48 observed when GTG 5 (0.92) and OPP 16 (0.85) primers were used alone or combined with RAPD-PCR and BOX-PCR (0.99). PCR-based fingerprinting methods are considered as a simple and easily applicable typing technique and potentially available to any molecular laboratory. ERIC-PCR is a useful method for bacterial DNA typing for analysis and evaluation of fingerprinting. It is used in the epidemiology of Salmonella spp. (Sedeik et al., 2019). It was reported that the Rep-PCR fingerprinting technique has been used as an epidemiological tool for several bacterial pathogens (Suh and Song, 2006). ERIC and BOX-PCR amplification had the ability to detect a highly genetic homogeneity among S. Enteritidis serotype isolates from both chicken and human except one isolate, which originated from chicken and showed a different DNA band pattern from other isolates (Suh and Song, 2006). The greater ability of rep- PCR to discriminate for genotyping of Salmonella subspecies when compared with PFGE, given the equally high reliability of both genotyping methods, was previously reported (Weigel et al., 2004). It was suggested that RAPD, ERIC-PCR, REP-PCR, BOXAIR-PCR are good discriminatory techniques to type the different clinical Salmonella isolates and these methods are sufficient to determine genetic relationships among Salmonella strains for epidemiological purposes when different techniques were combined (Hashemi and Baghbani-arani, 2015). It was reported that BOX-A1R-based repetitive extragenic palindromic- PCR (BOX-PCR) is considered to be the best method referring to other 49 repetitive element-based PCR typing methods, specifically, (ERIC)-, poly- trinucleotide (GTG)5-, and repetitive extragenic palindromic (REP-PCR). BOX-PCR provides a convenient molecular typing method to distinguish Salmonella spp. of the same and different serotypes according to genetic relatedness and should be proper for application in typing and tracking route of transmission in outbreaks. Similar results were reported by Poonchareon et al. (2019) and Lozano-Villegas et al. (2019) who showed that BOX-PCR can differentiate the genetic relationship between Salmonella isolates as well as grouping them into different clusters according to their origin. However, both ERIC-PCR and REP-PCR placed all Salmonella isolates of the same type into one group (Poonchareon et al., 2019). Previously, it was shown that the PCR-ribotyping technique had a very low discrimination power. However, the RAPD-PCR typing technique using specific primers which it was proposed as a simple and useful method for discriminating isolates between and within Salmonella serotypes (Del Cerro et al., 2002). The virulence of Salmonella is linked to a combination of chromosomal and plasmid factors (Yehia et al., 2020). Many virulence factors proved to play different roles in the pathogenesis of Salmonella infections. These virulence factors can be referred to as a virulence-associated plasmid gene or to a group of virulence factors located on chromosomes such as flagella, capsule, adhesion systems, and type III secretion systems (T3SS) encoded on the Salmonella pathogenicity islands (SPIs) (Jajere, 2019). The T3SS is regarded as the most important virulence factor of Salmonella (Lou et 50 al.,2019). Other studies showed that S. enterica as well as other enteropathogenic pathogens produce different virulence factors, which play a role in adhesion systems including adhesins, invasins, fimbriae, hemagglutinins, exotoxins, and endotoxins. These virulence factors assist the pathogenic Salmonella serotypes to colonize its host through the process of attachment, invasion, survival, and evasion of the defense mechanisms of the host (Jajere, 2019). Information about the virulence factors among Salmonella serovars appears to be lacking in Palestine. Virulotyping techniques are useful approaches to study Salmonella epidemiology. Several studies on Salmonella spp. virulotyping (Herrero et al., 2006; Soto et al., 2006; Capuano et al., 2013) have been conducted, little information is known about the relationship between the strains detected in food and their pathogenicity in human hosts. The studies showed that there are many virulence factors detected in Salmonella genus, certain of these factors are limited and exclusive to specific serotypes. Some of these virulence factors can be expressed and activated during the time of infection process inside the host cells (Elemfareji and Thong, 2013). Salmonella Typhimurium isolates have a range of virulence factors that play a role in Salmonella infection, diseases and interact with their host cells (Tarabees et al., 2017). In the current study, 17 virulence genes were targeted by mPCR to characterize 28 S. Typhimurium isolates virulence, these factors include invA, orgA, prgH, tolC, sopB, lpfC, cdtB, pefA, spaN, sipB, iroN, sitC, pagC, msgA, spiA, sifA and spvB. Only 13 virulence genes were detected in these 28 S. 51 Typhimurium isolates. The remaining virulence factors were not detected in all the S. Typhimurium isolates. Based on the combination of presence and absence of virulence genes, 8 profiles were detected among these isolates, the most common genetic profile was V5 (each 32.1%). Of these 17 Salmonella genes assayed by mPCR in the current study, only 12 of these genes are located in pathogenicity islands (PAIs) or pathogenicity islets, these included invA, orgA, prgH, spaN, sipB, sitC, pagC, msgA, spiA, sopB, lpfC, and sifA. The other2 genes included pefA and spvB are found on plasmids, while the remaining 3 genes (iroN, tolC, and cdtB) reside somewhere in the Salmonella genome (Skyberg et al., 2006).The following 14 genes that targeted by mPCR in the current study, included invA, orgA, prgH, spaN, tolC, sipB, pagC, msgA, spiA, sopB, lpfC, pefA, spvB, and sifA encode products that play an important role in a pathogenesis process, such as a cellular invasion, survival within a cell, and adhesin or pili production. The invA, prgH, spaN, sipB, spiA, and sifA genes are also associated with type III secretion system. Other remaining virulence genes, included iroN and sitC are linked with iron acquisition and cdtB virulence gene is connected with toxin synthesis (Skyberg et al., 2006). Results of the current study are in contrast to a previous study from Egypt, which reported that only 9 genes sitC, iroN, sopB, sifA, lpfC, span, sipB, invA, and tolC were successfully amplified in cases of S. Typhimurium isolated from chicken meat (Tarabees et al., 2017). PCR for the invA gene 52 is a rapid and reliable technique with a possible diagnostic application for the identification of Salmonella spp. The invA virulence gene is the most common and clinically significant genetic marker for the serovar that causes salmonellosis globally. The marker is found in both S. Typhimurium and S. Enteritidis (Yehia et al., 2020). The invA gene is used because it contains sequences specific to the genus, Salmonella (Yehia et al., 2020). Therefore, the invA gene which isa genus-specific gene was detected in all isolates. The protein product of this gene is necessary for the invasion of intestinal epithelial cells in hosts (Darwin and Miller, 1999).Our report corroborates many recent studies in Egypt (Awadallah and Abd-Elall, 2015) and Nigeria (Smith et al., 2015) conducted on Salmonella isolated from humans, animals, food, and water samples in which invA gene (284 bp) was prevalent at 96%.A wide prevalence of this gene (100%) had also been recorded earlier among Salmonella isolates, irrespective of their serovars or sample source by previously published works (Helmy et al., 2009; Moussa et al., 2010; Shanmugasamy et al., 2011; Fazl et al., 2013; Rowlands et al., 2014; Mohamed et al., 2014; Ammar et al., 2016; Ranjbar et al., 2017, Proroga et al., 2018; Thung et al., 2018; Elkenany et al., 2019). The invA gene is considered a useful marker or target gene for molecular investigation of Salmonella serotypes by PCR technique (Rowlands et al., 2014). The Salmonella outer protein encoded by sopB gene was found in 50% of S. Typhimurium isolates. This factor is located in SPI-5, associated with TTSS-1, and it is required for full virulence in a murine model (Elemfareji 53 and Thong, 2013). A study from Malaysia reported that 50% of the S. Typhimurium isolates harbored sopB virulence gene (Thung et al., 2018). The obtained percentage was approximately similar to that reported from S. Typhimurium (44.4%) isolated from broilers in Egypt (Ammar et al., 2016). The occurrence of sopB factor in this study was less than that reported from S. Typhimurium isolated in India, which showed that all tested S. Typhimurium isolates carried sopB gene (Rahman, 2006). Fimbriae in Salmonella spp. play a significant role in the pathogenicity, because they contribute to the attachment of these pathogens to the host epithelial cells. The plasmid-encoded fimbriae are encoded by the pef operon (Murugkar et al., 2003). Among the S. Typhimurium isolates tested, the pefA gene was detected in 35.7% of the isolates. The obtained percentage was about similar to that reported previously from S. Typhimurium isolates (44.4%) recovered from broilers in Egypt (Ammar et al., 2016), and was in contrast to another study from Malaysia where all S. Typhimurium isolates obtained from beef meat usually carried pefA gene (Thung et al., 2018).In addition, the results of this study were in contrast to another recent study from Egypt, which showed that all S. Typhimurium isolates recovered from cloacal swabs, farm environment, and whole chicken carcasses samples did not carry pefA gene (Elkenany et al., 2019). Also, the result of this study was in contrast to another recent study from Italy, which showed that the occurrence of pefA gene among S. Typhimurium isolates of human origin was 8.2% (Proroga et al., 2018). In Brazil, the occurrence of the virulence gene pefA was more than that in 54 Palestine; it was 66.7% among S. Typhimurium isolates, associated or not with foodborne salmonellosis (Rowlands et al., 2014). Virulotyping of S. Typhimurium serotype in this study showed that the occurrence of prgH gene was 46.4%. This result was, in contrast, to a study conducted by Srisanga et al., (2017), which showed that the occurrence of this gene among different Salmonella enterica including S. Typhimurium serotype recovered from dogs and cats was 91.8% (Srisanga et al., 2017). The presence of virulence genes in S. Typhimurium isolates recovered from different types of food samples may play an important role in infection. Pathogenicity of Salmonella strains included S. Typhimurium is controlled by a set of factors encoded by specific virulence genes that assist these types of pathogens to express the virulence in the host cells, at the end this led to the appearance of typical symptoms of infection in an infected individual (Gharieb et al., 2015). Conclusion The preliminary data from this study have considerable epidemiological implications. Molecular assays using PCR-based methods for identification, virulotyping, and genotyping of S. Typhimurium is a useful approach for drawing up a group of genes to use in the epidemiological characterization of S. Typhimurium isolates. Contamination of food with Salmonella especially with S. Typhimurium indicates the bad microbiological quality of food. This serotype of Salmonella may act as a source of human infection. The present study emphasizes the need for 55 rigorous public health and hygienic measures during food preparation to lower the human health hazard risk associated with Salmonella diseases. Moreover, the recovered S. Typhimurium isolates exhibiting multiple virulence genes, which constitute a possible risk to humans from consumption of these products. Early detection of the virulence gene provides many benefits for public health, especially for rapid diagnosis and control of contamination and infection. Recommendations • Strict hygiene and control measures should be applied in order to avoid contamination that could occur from the production phase to consumption. • Increase monitoring and surveillance efforts to improve knowledge of the incidence and seriousness of these food borne diseases and related hazards. • Increase awareness among individuals behaviors related to safe food- handling practices and commitment to hygienic practices. • Improve the inspection activities including periodic meat inspection and regular sampling from different slaughterhouses and local markets. 56 References Abebe E, Gugsa G, Ahmed M. Review on Major Food-Borne Zoonotic Bacterial Pathogens. Journal of Tropical Medicine 2020; 1-19. Abed Al-Daym M (2019). Determination of the rate of Salmonella Enteritidis in layer farms by polymerase chain reaction. MSC Thesis. Faculty of Pharmacy Nursing and Health Professions, Birzeit University, Ramallah, Palestine, 1-68. Abuseir S, Abed Al-Daym M, Adwan G, Khraim N. Prevalence of Salmonella spp. in layer and broiler farms in Palestine in 2018, with special emphasis on Salmonella enterica serovar Enteritidis. Journal of the Hellenic Veterinary Medical Society 2020, 72(1):2723-2732 Adwan G, Adwan K, Jarrar N, Salama Y and Barakat A. Prevalence of seg, seh and sei genes among clinical and nasal Staphylococcus aureus isolates. British Microbiology Research journal 2013; 3(2):139-149. Adwan G, Haya I. Prevalence and Characterization of Staphylococcus aureus Isolated from Bulk Tank Milk Dairy Cow Farms in West Bank-Palestine. Microbiology Research Journal International 2018; 23(5): 1-13. Adwan G, Rabaya' D, Adwan K, Al-Sheboul S. Prevalence of β-lactamases in clinical isolates of Enterobacter cloacae in the West Bank-Palestine. International Journal of Medical Research and Health Sciences 2016; 5(7): 49-59 57 Adwan G, Rabaya D. Prevalence and molecular characterization of β- lactamases in clinical isolates of Klebsiella pneumoniae from North of Palestine. International Journal of Current Research 2016; 8(3): 28058-28067. Adwan G, Shtayah A, Adwan K, Al-Sheboul S, Othman S. Prevalence and molecular characterization of P.aeruginosa isolates in the West Bank- Palestine for ESBLs, MBLs, and integrons. Journal of Applied Life Sciences International 2016; 8(2):1-11, Article no. JALSI.29259. Adzitey F, Huda N, Ali GRR. Molecular techniques for detecting and typing of bacteria, advantages and application to foodborne pathogens isolated from ducks. Three Biotech 2013; 3(2): 97-107. Ahmed AM, Shimamoto T, Shimamoto T. Characterization of integrons and resistance genes in multidrug-resistant Salmonella enterica isolated from meat and dairy products in Egypt. International Journal of Food Microbiology 2014; 189: 39–44 Akoachere J-F T K, Tanih N F, Ndip L M, Ndip R N. Phenotypic Characterization of Salmonella Typhimurium Isolates from Food- animals and Abattoir Drains in Buea, Cameroon. Journal of Health, Population and Nutrition 2009; 27(5): 612–618. DOI: 10.3329/jhpn.v27i5.3637 Albufera U, Bhugaloo-Vial P, Issack M, Jaufeerally-Fakim Y. Molecular characterization of Salmonella isolates by REP-PCR and RAPD analysis. Infection, Genetics and Evolution 2009, 9: 322–327. 58 Al-Dawodi R, Farraj MA, Essawi T. Antimicrobial resistance in non-typhi Salmonella enterica isolated from humans and poultry in Palestine. Journal of infection in developing countries 2012; 6(2):132-136. http://doi.org/10.3855/jidc.1167 Al‐Rifai RH, Chaabna K, Denagamage T, Alali WQ. Prevalence of enteric non ‐ typhoidal Salmonella in humans in the Middle East and North Africa: A systematic review and meta-analysis. Zoonoses and Public Health 2019; 1-28. DOI: 10.1111/zph.12631 Amajoud N, BouchrifB, El Maadoudi M, Skalli SN, Karraouan B, El Harsal A, El Abrini J. Prevalence, serotype distribution, and antimicrobial resistance of Salmonella isolated from food products in Morocco. Journal of Infection in Developing Countries 2017; 11(2):136-142. Ammar AM, Mohamed AA, Abd El-Hamid MI, El-Azzouny MM. Virulence genotypes of clinical Salmonella serovars from broilers in Egypt. Journal of infection in developing countries 2016; 10(4): 337-346. Anumolu VK, Lakkineni VR. Screening of poultry samples for Salmonella Typhimurium by PCR assay. Veterinary World 2012; 5(3):169-172 Argaw S, Addis M. A review on staphylococcal food poisoning. Food Science and Quality Management 2015; 40: 59-71. 59 Awadallah MAI, Abd-Elall AMM. Diversity and virulence-associated genes of Salmonella enterica serovars isolated from wastewater agricultural drains, leafy green producing farms, cattle, and human along their courses. Revue de Médecine Vétérinaire 2015; 166(3):96-106 Babu TEG, Mastan SA. Molecular Characterization of Biodegrading Bacteria from Soil Sample. Biomedical and Pharmacology Journal 2011;4(1):87-93. Borges KA, Furian TQ, Borsoi A, Moraes HLS, Salle CTP, NascimentoVP. Detection of virulence-associated genes in Salmonella Enteritidis isolates from chicken in south of Brazil. Brazilian Journal of Veterinary Research (Pesquisa Veterinária Brasileira) 2013; 33:1416-1422. Brenner FW, Villar RG, Angulo FJ, Tauxe R, Swaminathan B. Salmonella Nomenclature. Journal of Clinical Microbiology 2020;38(7). DOI: https://doi.org/10.1128/JCM.38.7.2465-2467.2000 Busani L, Cigliano A, Taioli E, Caligiuri V, Chiavacci L, Di Bella C, Battisti A, Duranti A, Gianfranceschi M, Nardella MC, Ricci A, Rolesu S, Tamba M, Marabelli R, Caprioli A; Italian Group of Veterinary Epidemiology. Prevalence of Salmonella enterica and Listeria monocytogenes contamination in foods of animal origin in Italy. Journal of Food Protection 2005; 68(8):1729-1733. 60 Capuano F, Mancusi A, Capparelli R, Esposito S, Proroga YT. Characterization of drug resistance and virulotypes of Salmonella strains isolated from food and humans. Foodborne Pathogens and Disease 2013;10(11):963-968. Chen J, Tang J, Liu J, Cai Z, Bai X. Development and evaluation of a multiplex PCR for simultaneous detection of five foodborne pathogens. Journal of Applied Microbiology 2012; 112(4): 823-830. Darwin KH, Miller VL. Molecular basis of the interaction of Salmonella with the intestinal mucosa. Clinical microbiology reviews 1999;12:405-428. De Giusti M, De Medici D, Tufi D, Marzuillo C, Boccia A. Epidemiology of emerging foodborne pathogens. Italian Journal of Public Health 2007; 4(1): 24-31. Del Cerro A, Soto SM, Anderas EL, Gonzalez-Hevia MA, Guijarro JA, Mendoza MC. PCR-based procedures in detection and DNA- fingerprinting of Salmonella from samples of animal origin. Food Microbiology 2002;19(6):567-575. Dhanalakshmi M, Balakrishnan S, Sangeetha A. Prevalence of Salmonella in chicken meat and its slaughtering place from local markets in Orathanadu, Thanjavur district, Tamil Nadu. Journal of Entomology and Zoology Studies JEZS 2018; 6(2): 2468-2471. 61 Diep B, Barretto C, Portmann AC, Fournier C, Karczmarek A, Voets G, Li S, Deng X, Klijn A. Salmonella serotyping; comparison of the traditional method to a microarray-based method and an in silico platform using whole-genome sequencing data. Frontiers in Microbiology 2019; 10:2554. Dombek PE, Johnson LK, Zimmerley ST. Sadowsky M.J. Use of repetitive DNA sequences and the PCR to differentiate Escherichia coli isolates from human and animal sources. Applied and Environmental Microbiology 2000; 66:2572–2577. EFSA (European Food Safety Authority) and ECDC (European Centre for Disease Prevention and Control). Multi-country outbreak of Salmonella Enteritidis phage type 8, MLVA type 2-9-7-3-2 and 2-9-6- 3-2 infections, 7 March 2017. European Food Safety Authority Journal: Stockholm and Parma; 2017. EFSA (European Food Safety Authority) and ECDC (European Centre for Disease Prevention and Control). The European Union summary report on trends and sources of zoonoses, zoonotic agents, and food- borne outbreaks in 2015. European Food Safety Authority Journal 2016; 14(12):4634, 231 pp. doi:10.2903/j.efsa.2016.4634 EFSA (European Food Safety Authority) and ECDC (European Centre for Disease Prevention and Control). The European Union One Health 2018 Zoonoses Report. European Food Safety Authority Journal 2019; 17(12): 1-276. 62 EFSA (European Food Safety Authority) and ECDC (European Centre for Disease Prevention and Control). The European Union summary report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals, and food in 2013. European Food Safety Authority Journal 2015;13(2):4036. EFSA, ECDC. The European Union summary report on trends and sources of zoonoses, zoonotic agents, and food-borne outbreaks in 2017. European Food Safety Authority journal 2018;16(12), e05500. El-Baz AH, El-Sherbini M, Abdelkhalek A, Al-Ashmawy MA. Prevalence and molecular characterization of Salmonella serovars in milk and cheese in Mansoura city, Egypt. Journal of Advanced Veterinary and Animal Research 2017; 4(1):45-51. Elemfareji OI, Thong KL. Comparative Virulotyping of Salmonella Typhi and Salmonella Enteritidis. Indian Journal of Microbiology 2013; 53(4):410-417. El-Kader HA, EL-Toukhy EI, Hanan AF, Masoud EA, EL-Berbawy SM. Molecular Study on Virulence Gene of Some Isolates of Salmonellae Isolated from Chicken Meat and Some Meat Products. Animal Health Research Journal 2015; 3: 310-317. Elkenany R, Elsayed MM, Zakaria AI, El-Sayed SA, Rizk MA. Antimicrobial resistance profiles and virulence genotyping of Salmonella enterica serovars recovered from broiler chickens and 63 chicken carcasses in Egypt. BioMed Central Veterinary Research 2019; 15(1):124. El-Tayeb MA, Ibrahim ASS, Al-Salamah AA, Almaary KS, Elbadawi YB. Prevalence, serotyping, and antimicrobials resistance mechanism of Salmonella enterica isolated from clinical and environmental samples in Saudi Arabia. Brazilian Journal of Microbiology 2017;48(3):499- 508. Eng SK, Pusparajah P, Mutalib Ab, Syakimaet N, Ser HL,Chan KG, Lee LH. Salmonella: A review on pathogenesis, epidemiology, and antibiotic resistance. Frontiers in Life Science 2015; 1-8. Fazl AA, Salehi TZ, Jamshidian M, Amini K, Jangjou AH. Molecular detection of invA, ssaP, sseC and pipB genes in SalmonellaTyphimurium isolated from human and poultry in Iran. African Journal of Microbiology Research 2013; 7(13):1104-1108. Ferrari RG, Rosario DKA, Cunha-Neto A, Mano SB, Figueiredo EES, Conte-Junior CA.Worldwide Epidemiology of Salmonella Serovars in Animal-Based Foods: a Meta-analysis. Applied and Environmental Microbiology 2019; 85(14):e00591-19. Gharieb RM, Tartor YH, Khedr MH