An-Najah National University Faculty of Graduate Studies Molecular Phylogenetic Relationship among Closely Related Species of the Clover Genus (Trifolium – Leguminosae) in Palestine / West Bank By Rana Malek Mohammad Hassan Supervisor Dr. Ghadeer Omar Co-supervisor Dr. Ghaleb Adwan This Thesis is submitted in Partial Fulfillment of the Requirements for The Degree of Master of Life Science (Biology), Faculty of Graduate Studies, An-Najah National University, Nablus-Palestine. 2017 ii Molecular Phylogenetic Relationship among Closely Related Species of the Clover Genus (Trifolium – Leguminosae) in Palestine / West Bank. By Rana Malek Mohammad Hassan This Thesis was Defended Successfully on 17/ 9/ 2017 and approved by: Defense Committee Members Signature 1. Dr. Ghadeer Omar / Supervisor .…...………. 2. Dr. Ghaleb Adwan / Co- Supervisor ..…..…….…. 3. Dr. Jamil Harb / External Examiner ….……….… 4. Dr. Heba Al- Fares / Internal Examiner ..…..……….. iii Dedication I dedicate my thesis to my family and friends. Mom and Dad, I could never have done this without your faith, support and constant encouragement. Thank you for teaching me to believe in Allah, in myself and in my dreams. To my sister and brothers (Haya, Mohammad and Munther) for cheering me until the end iv Acknowledgments I would like to express my sincere special thanks and gratitude to my supervisors Dr. Ghadeer Omar and Dr. Ghaleb Adwan for their encouragement, guidance, patience and help throughout this study. I also thank my friends and best colleagues (Dina Asir, Thabat Khatib, Dalya Al masri, Manar Ghanem and Mayes Mofeed) for their support through my thesis. Thanks for the faculty members of Biology and Biotechnology department at An-Najah National University for their efforts during my Master program. v القرارا الرسالة التي تحمل العنوان : ةمقدم ،أدناه ةأنا الموقع Molecular Phylogenetic Relationship among Closely Related Species of the Clover Genus (Trifolium – Leguminosae) in Palestine /West Bank. بإستثناء ما تمت اإلشارة إليو ،أقر بأن ما اشتممت عميو ىذه الرسالة إنما ىو نتاج جيدي الخاص أو أي جزء منيا لم يقدم من قبل لنيل أي درجة أو لقب عممي ، و أن ىذه الرسالة ككل ،حيثما ورد . لدى أي مؤسسة أو بحثية أخرى Declaration The work provided in this thesis, unless otherwise referenced. Is the researcher`s own work and has not been submitted from anywhere else, for any other degree or qualification. Student’s name: ةإسم الطالب: Signature: التوقيع: Date: التاريخ: vi Table of Contents No. Content Page Dedication iii Acknowledgements iv Declaration v Table of Contents vi List of Tables viii List of Plates and Figures ix List of Abbreviations x Abstract xi Chapter One: Introduction 1 1.1 General Background 2 1.2 Leguminosae Family 4 1.3 Taxonomic History of the Clover genus (Trifolium) 6 1.4 Molecular Phylogenic Relationships 7 1.5 Aim of the study 9 Chapter Two :Materials and Methods 10 2.1 Plant Materials 11 2.2 Identification, Classification and Taxonomy of the Collected Samples 13 2.3 Plant DNA Extraction 14 2.4 PCR Amplification and Gel Electrophoresis 15 2.5 DNA Cleaning and Sequencing 16 2.6 Sequence Alignment and Analysis 16 Chapter Three : Results 18 3.1 Morphological Characterization of Leguminosae Family 19 3.1.1 Classification of Leguminosae Family 19 3.1.2 Description of the Leguminosae Family 19 3.1.3 Key the Studied Trifolium Species 20 3.1.4 Description of the Clover Genus (Trifolium L.) and the Studied Species 21 3.2 Molecular Characterization of the Studied Trifolium Species 30 3.2.1 Obtained DNA Extracted Quantity and Quality of the Investigated Trifolium Species 30 3.2.2 Agarose Gel Electrophoresis Analysis for the Amplified ITS Sequences 30 3.2.3 Genetic Relationship among Closely Related Species of the Clover Genus (Trifolium- Leguminosae ) 31 vii Chapter Four : Discussion 37 4.1 Taxonomy of Trifolium 38 4.2 Optimization of Plant DNA Extraction 41 Conclusions and Recommendations 43 References 45 Appendixe 55 ب الملخص viii List of Tables No. Contents Page Table: 2.1 Scientific and common names of studied species with their locations and lifespan. 12 Table: 2.2 Voucher numbers, GenBank numbers of the studied species and their scientific names. 13 Table: 3.1 DNA extract quantity and quality of the studied species. 30 Table: 3.2 Genetic differences between ITS region sequences obtained from studied Trifolium species. 36 ix List of Plates and Figures No. Content Page Plate1 Colored photographs of studied species. 27 Plate2 Colored photographs of studied species. 28 Plate3 Map of Palestine showing the distribution of the studied species 29 Figure 3.1 Agarose gel electrophoresis analysis showing detection of amplified ITS regions of different species of Trifolium. 31 Figure 3.2 Phylogenetic analysis by Neighbor-Joining method based on ITS site. Sequences of twelve classified samples Trifolium L. species, as well as S. candidissima as an out group. 34 x List of Abbreviations DNA Deoxyribonucleic acid cpDNA Chloroplast deoxyribonucleic acid mtDNA Mitochondrial deoxyribonucleic acid rDNA Ribosomal deoxyribonucleic acid RNA Ribonucleic acid rRNA Ribosomal ribonucleic acid RNase Ribonuclease ITS Internal Transcribed Spacer PCR Polymerase Chain Reaction Taq Thermusaquaticus Mgcl2 Magnesium Chloride NH4cl Ammonium Chloride Hgcl Mercuric Chloride CTAB Cetyltrimethyl Ammonium Bromide SDS Sodium dodecyl sulfate PVP Polyvinylpyrrolidone EDTA Ethylenediaminetetraacetic acid Nacl Sodium chloride Tris-Hcl Tris(hydroxymethyl)aminomethane-hydrochloric acid TE Tris -EDTA g Gram mg Milligram µg Microgram ng Nanogram L Litter ml Milliliter µl Microliter μM Micromolar nm Nanometre pH potential of hydrogen w/v Weight /volume percentage concentration v/v Volume/ volume percentage rpm Revolutions per minute h Hour sec Second min Minute bp base pair BLAST Basic Local Alignment Search Tool BLASTn Nucleotide Basic Local Alignment Search Tool MEGA6 Molecular Evolutionary Genetics Analysis version 6 K2P kimura 2- parameter model V. no. Voucher number xi Molecular Phylogenetic Relationship among Closely Related Species of the Clover genus (Trifolium – Leguminosae) in Palestine / West Bank. By Rana Malek Mohammad Hassan Supervisor Dr. Ghadeer Omar Co- supervisor Dr. Ghaleb Adwan Abstract Leguminosae family is the third largest family of angiosperms; which comprises three sub-families: Caesalpinioideae, Mimosoideae and Papilionoideae. Legumes are flowering plants in Leguminosae family that include a large number of species. Trifolium L. (Clover genus, True Clover) is one of the most important genera in legumes with agricultural values. A Mediterranean region contains the highest biological diversity due to the variation in Mediterranean climate. The native distribution of Clover genus is found there. To resolve the conflicts in the morphological characters in some of the closely related species of Trifolium, it was necessary to use molecular markers. Internal Transcribed Spacer (ITS) regions of the nuclear ribosomal DNA (nrDNA) are the most widely used marker in plant research. They have xii been proved to be useful source of information for phylogenetic studies in many angiosperm families including Leguminosae. Fresh specimens of different species of Trifolium were collected during the flowering period (March – May 2017) from different locations in Palestine/West Bank. Then a representative plant specimen of each species was deposited at An-Najah National University Herbarium. Depending on Flora Palaestina, and using of Stereo microscope, the collected samples were identified and classified based on their morphological characteristics. CTAB extraction protocol was followed for plant genomic DNA extraction. The ITS regions (ITS-1 spacer, 5.8S rDNA and ITS-2 spacer) were amplified using universal primers. Phylogenetic tree was constructed for the 12 classified samples that belong to Clover genus (Trifolium L.) using Neighbor-Joining method and Salvia candidissima was used as the out-group. Kimura's 2-parameter method was used to compute Pair-wise distances. All DNA sequences that were used in the study were deposited at the GeneBank database under accession numbers. Molecular ITS sequence analysis of both T.purpurem and T.dasyurum showed that they are identical species, since they have identical ITS sequences (0% bp differences) and were clustered together in the same clade I/ sub- clade Ia. This coincides with the high resemblance of their morphological characters. xiii T.campestre and T.grandiflorum could be regarded taxonomically as one species, since they also have identical ITS sequence (0% bp differences) and were clustered together in the same clade II/ sub-clade IIb in the constructed phylogenetic tree. Based on this study, it is recommended to identify both T.purpurem and T.dasyurum as same species. Accordingly depending on the nomenclature rules T.dasyurum (1832) can be considered as synonym to T.purpurem (1807), which can be referred as the valid name of that species. Similarly this can be applied to both T.campestre (1804) and T.grandiflorum (1767). The former one could be regarded as synonym to T.grandiflorum which could be taken as the valid name. In addition, the current conducted traditional morphological and molecular taxonomical study is the first of its type that was able to highlight the phylogenetic relationship among closely related species of the genus Trifolium in Palestine/West Bank. This paves the way for future in-depth researches on different more species of the same genus. In addition, using other molecular markers could reveal more clarification of the taxonomy of Trifolium different species. 1 Chapter one Introduction 2 1.1 General Background The Mediterranean climatic region was mainly delimited based on the bioclimatic criteria in spite of other possible categories as biogeography and floristic ones (Akman, 1982; 1999). Hot, arid summers and moist, cool winters characterize the Mediterranean climatic (Poluuin and Huxley, 1967). Arid lands, portraying a typical transition zone between the Saharo- Arabin desert biome and temperate climates which are represented by most of the eastern Mediterranean region including Turkey, Syria, Lebanon, Palestine and Jordan (Heywood, 1995a; 1995b; 2003). It is characterized by rich plant diversity due to its distinguishing position as a meeting point of the phytogeographical regions of the Mediterranean, Irano-Turanian, Saharo- Sindian and Sudano-Decanian; each of which have their own flora along with a large number of bioregional and pluriregional species (Davis and Heywood, 1994). The flora and vegetation of the eastern Mediterranean is of enormous variability which is represented by nearly 15,000 different plant species belonging to 1000 genera and 500 families (Heywood, 1995b). Accordingly, the Mediterranean Basin is one of 34 world biodiversity hotspots (Myers, 2003; Myers et al., 2000). Moreover, the Mediterranean region retains its biological significance due to a high level of plant endemism and the occurrence of many relict species (Greuter, 1991). Palestine locates at a meeting point between Europe, Asia and Africa in the southeastern of the Mediterranean Sea, which contributed to the diversity of phytogeographic zone, which in turn caused a large diversity in the Flora 3 of Palestine. Despite its small size, the West Bank which is located in the Palestinian Territories (PT) comprises approximately 3 percent of the world's biodiversity and contains high density of species as well as a large number of endemic species (endemic are only found in restricted regions and therefore unique genetic information) (ARIJ,1997). Distribution Atlas of plants in the Flora Palaestina area (Danin, 2004), comprises updated nomenclature, distribution and habitat data for the species in the area covered by Flora Palaestina (Zohary, 1966a; 1966b; 1972a; 1972b; Dothan, 1978a; 1978b; 1986a; 1986b; Dothan and Danin, 1991). Total number of 2750 species in 138 families listed in the Atlas and about 276 were not previously recorded in the Flora Palaestina. About 27 of them are found new to science, described after the publication of Flora Palaestina; 105 are new adventive species, 34 of them escaped from cultivation and established through spontaneous germination. The marked aliens in the study area were 160 species (5.8% of entire flora).The previous recorded data is still under updating in Flora of Israel on line recoding so far 2866 plant species of flowering seed vascular plants (Danin, 2006+). Several studies revealed that most dominant families in Palestine were the Compositae, Gramineae, Leguminosaes, Cruciferae, Labiatae and Liliaceae (ARIJ, 1997; Ali-Shtayeh and Jamous, 2002; 2003). Approximately 800 of these plants are rarely found and around 140 are endemic (Zohary, 1966a; 1966b). A total number of 334 plant species were recorded to be threatened in the West Bank and Gaza Strip (Ali-Shtayeh and Jamous, 2002). 4 There is an obvious association between legumes distribution in nature and their morpho-physiological differences with the soil characteristics, related to the nature of parent rock, soil chemical properties and soil texture (Piano and Francis, 1993). Legumes in the Mediterranean semiarid areas play a main role as a pasture plants for their forage quality and assisting nitrogen fixation, which are increase soil fertility and giving the nutritional requirements for other plant species (Crespo, 1997). 1.2 Leguminosae Family Leguminosae, (the Fabaceae family) is the third largest family of angiosperms; which comprises three sub-subfamilies: Caesalpinioideae, Mimosoideae and Papilionoideae, with approximately 727 Genera and 19,330 species. Legumes are flowering plants in Leguminosae family that include a large number of species. They are harvested as crops for human and animal consumption as well as for their oils, fibers, fuel and fertilizers (Lewis et al., 2005). Legumes vary in habit from annual, perennial herbs to shrubs and trees, ranging from the smallest plants of deserts to the tallest of rain forest trees (Rundel, 1989). Many species in Leguminosae family have the ability to fix atmospheric nitrogen via a symbiotic association with root-nodulating bacteria (McKey, 1994; Sprent, 2001). Based on morphological characterization, leaves of the Leguminosae family are usually of pinnate compound form, arranged alternately (one leaf per node). Their flowers are hermaphroditic (containing both the stamen and pistil), which makes the plants self-fertile. Moreover they have zygomorphic flowers with a five merous corolla. Flowers of the 5 Leguminosae family are composed of one large petal, known as standard, which folds over the rest petals for protection. Also, there are in front of the standard, two horizontal petals are known as wings, while, the other two petals known as the keel that are united by their margins. The fruit (pod) of Leguminosae family is often one celled. That is usually dehisces along two opposite longitudinal splits which is known by the legume fruit type. Pod of legumes may contain one or few seeds with large embryo and little endosperm for each seed. Irregular nodules on roots of these plants can absorb nitrogen, which is needed for plants growth (Zohary, 1987). The genus Trifolium L. (Clover) is one of the most important genera of the family Leguminosae, subfamily Papilionoideae with agricultural value (Zohary, 1972). Trifolium includes 250-300 species, including some of the most economically important species (Williams, 1987). However, according to the International Legume Database and Information System (ILDIS), only 217 species were accepted (Zohary and Heller, 1984).The name of the clover genus refers to the distinctive leaves that are usually composed of three leaflets (trifoliolate). Due to the higher species diversity found in the Mediterranean regions, the native distribution of Trifolium is generally found there, with a secondary center of distribution in north-eastern America, and now is widely distributed throughout the temperate and subtropical regions of the world (Zohary and Heller, 1984; Caradus, 1995). Flowers of Trifolium are usually small to medium-size (0.3 - 2.5 cm) arranged in capitate to spicate heads. Wing and keel (lower petals) are partially connate and their claws are 6 adnate to the staminal tube; banner (the upper petal) may also be connat to the lower petals, and sometimes to the free stamens (Hossain, 1961; Zohary and Heller, 1984). Corolla is persistent, marcescent or caducos with white, yellow, purple and fresh-colored or even pink to lilac color. Calyx is mostly tubular or campanulate that is generally persistent after anthesis (Zohary, 1972). Fruits are usually 1–2 seeded, but may contain up to nine seeds. The pods may be regularly and irregularly dehiscent. In later cases, pods are often of papery texture and wholly contained within the persistent corolla or calyx (Zohary, 1972). 1.3 Taxonomic History of the Clover Genus (Trifolium) Trifolium as an important genus in the Leguminosae family, subfamily Papilionoideae, was found to be closely related to the genera Medicago and Trigonella causing their classification in the same tribe Trifolieae (Heyn, 1981). Their pods characters are the main criteria to distinguish this genus among the three genera. The Medicago pods are spiral and coiled, but in Trigonella are usually straight or arcute. However Trifolium pods are more ovate or oblong (Hossain, 1961; Zohary and Heller, 1984). The clover genus has been subjected to various different taxonomic studies revealed in its classification into different sub taxa. The first of all was conducted by Linnaeus (1753) as he divided the genus into five groups, while, it was divided into seven ones by Seringe (1825). However, in 1832, Presl splitted the genus into nine new sub taxa. But Boissier in 1873 reduced the number of the sections to seven. Later on, Lojacono (1883) 7 distinguished two subgenera within the genus, and their subsequent classifying in to 11 sections and the second into two. Although, Hossain (1961) divided the genus into eight subgenera, another approach was adopted by Zohary and Heller in (1984), as they classified the genus into eight sections. These sections were referred to Lotoidea, Paramesus, Mystillus, Vesicaria, Chronosemium, Trifolium, Tricocephalum, and Involucrarium. Six sections out of them were restricted to the Old World or Eurasia and some extend to Africa. Only Involucrarium and Trifolium were distributed in the New World, in North and South America (Zohary and Heller, 1984; Steiner et al., 1997). 1.4 Molecular Phylogenic Relationships In Plant cells, the suitable sources of DNA to study genetic diversity and phylogenetic relationships are nuclear genome (DNA), mitochondrial genome (mt DNA) and chloroplast genome (cp DNA). However ribosomal DNA (rDNA) genes are specific genes that can be used for genetic diversity of nuclear genome (Zhang et al., 1999). As molecular methods are direct tools for vital genetic information, they are used in research on plant diversity. Moreover, choosing the appropriate molecular markers enables the detection of phylogenetic relationship among different plant taxa (Ghariani et al., 2003; Poyraz et al., 2012; Taşkın et al., 2012). Internal Transcribed Spacer (ITS) regions of the nuclear ribosomal DNA (nrDNA) are the most widely used marker in plants research (Patwardhan 8 et al., 2014). They have been proved to be useful source of information for phylogenetic studies in many angiosperm families including Leguminosae (Alvarez and Webdel, 2003). Regions between 18S (small rRNA subunit) and 28S (large rRNA subunit) in nuclear ribosomal DNA are exploited in several diversity studies (Planco and Perez, 1997; Penteado et al., 1996; Nickrent and Patrick, 1998). Trifolium is a member of a large monophyletic clade of 45 genera, which are commonly referred to Temperate, Herbaceous Clade (THC) (Polhill, 1981; Lavin et al., 1990; Doyle, 1995). However, more recently they are known as Internal Repeat Lacking Clade (IRLC) (Hu et al., 1999). The IRLC is composed of the tribes Trifolieae and Fabeae, and the genera Cicer, Galega, and Parochetus (Liston and Wheeler, 1994; Sanderson et al., 1996; Wojciechowski et al., 2004). Molecular phylogenetic studies have proved strongly that Trifolium is embedded within “vicioid clade” (Sanderson and Liston, 1995; Sanderson et al., 1996). Within the vicioid clade, Fabeae and Trifolieae comprise a monophyletic group. Similarly Steele and Wojciechowski in (2003) conducted a phylogenetic analysis of the Trifolieae and Fabeae based on cpDNA matK, upon strong support for this monophyly of Trifolium was provided. Moreover, this monophyly has been demonstrated by the results obtained from nuclear ITS and chloroplast trnL molecular analysis among 218 Trifolium species (Ellison et al., 2006). On the contrary, Watson (2000) contradicted the monophyly of most Trifolium sections which were recognized by Zohary and Heller (1984). 9 His study was conducted on 59 Old World Trifolium species based on nrDNA ITS sequences and restriction site analysis of PCR-amplified DNA. In addition the utility of nrDNA ITS sequence in resolving the phylogenetic relationship among closely related species of three subspecies of Trifolium nigrescens was performed (Williams et al., 2001). As no previous molecular phylogenetic analysis of Trifolium has sampled the taxonomic breadth of its identified species in Zohary (1966). Therefore, they were the aim of this study to highlight the taxonomical issue in respect to their identification and classification. 1.5 Aim of the Study To resolve the taxonomic conflicts in morphological dependent classification of closely related species of Trifolium in Palestine / West Bank based on the molecular analysis of Internal Transcribed Spacer (ITS) regions. 10 Chapter Two Materials and Methods 11 2.1 Plant Materials Fresh specimens of different species of Trifolium were collected during the flowering period (March – May 2017) from different locations in Palestine/West Bank. Representative samples of the species under the study were identified depending on taxonomical characteristics: shape of flowering heads, color of petals, arrangement of leaves, form of stipules, form of calyx, and number of nerves on calyx. Specimens were pressed till drying in appropriate conditions at An-Najah National University Herbarium. Table 2.1 shows scientific and common names of the studied species with their locations and Lifespan. The samples were chemically poisoned using a mixture of mercuric chloride and ammonium chloride (150 g of mercuric chloride (HgCl) and ammonium chloride (NH4Cl) were dissolved in as little water as possible, then 10 L of 96% ethanol was added to the previous mixture). The poisoned specimens were labeled with the date of collection, location, name of the collector, then mounted on herbarium sheets and given a herbarium voucher number. Table 2.2 shows the Voucher numbers of the studied species and their scientific names. The sheets were deposited at the herbarium, Department Biology and Biotechnology, Faculty of Science at An – Najah National University. 12 Table 2.1: Scientific and Common names of studied species of Trifolium with their locations and Lifespan . No. of samples Scientific name Locations Common name Lifespan 1. Trifolium purpureum Loisel. Tulkrem / Far'oun Purple clover Annual 2. Trifolium purpureum Loisel. Tulkrem / Far'oun Purple clover Annual 3. Trifolium purpureum Loisel. Tulkrem / Far'oun Purple clover Annual 4. Trifolium purpureum Loisel. Jenin / near Arab American University Purple clover Annual 5. Trifolium purpureum Loisel. Jenin / near Arab American University Purple clover Annual 6. Trifolium campestre Schreb. Nablus / Beit -wazan Low Hop Clover Annual 7. Trifolium campestre Schreb. Nablus / Beit -wazan Low Hop Clover Annual 8. Trifolium stellatum L. Jenin / near Arab American University Star Clover Annual 9. Trifolium stellatum L. Jenin / near Arab American University Star Clover Annual 10. Trifolium stellatum L. Jenin / near Arab American University Star Clover Annual 11. Trifolium dasyurum C. Jericho/Wadi Al Qalt Eastern star clover Annual 12. Trifolium dasyurum C. Jericho/Wadi Al Qalt Eastern star clover Annual 13 Table 2.2: Voucher numbers, GenBank accession numbers of the studied species and their scientific names. No. of sample Scientific name Voucher no. GenBank no. 1. Trifolium purpureum Loisel. 1863 MF589956 2. Trifolium purpureum Loisel. 1864 MF589957 3. Trifolium purpureum Loisel. 1865 MF589958 4. Trifolium purpureum Loisel. 1883 MF589959 5. Trifolium purpureum Loisel. 1884 MF589960 6. Trifolium campestre Schreb. 1878 MF589961 7. Trifolium campestre Schreb. 1879 MF589962 8. Trifolium stellatum L. 1886 MF589963 9. Trifolium stellatum L. 1887 MF589964 10. Trifolium stellatum L. 1888 MF589965 11. Trifolium dasyurum C. 1856 MF589966 12. Trifolium dasyurum C. 1857 MF589967 2.2 Identification, Classification and Taxonomy of the Collected Samples Depending on Flora Palaestina (Zohary, 1966a), and using of Stereo microscope, the collected samples were identified and classified based on morphological characteristics:  Habit: annual or perennial species.  Leaves: if trifoliolate, leaflets entire or dentate, leaf arrangement alternate or opposite.  Inflorescence: capitate or spicate heads.  Calyx: tubular or campanulate, number of nerves, equal or unequal teeth, throat of calyx open or closed, with the presence of callosity or by a ring of hairs. 14  Corolla color: colored with pink, white, lilac, violet, or 2-colored. 2.3 Plant DNA Extraction Genomic DNA was extracted from fresh plant material of each plant species under the study (100 mg fresh leaves weight) using Cetyltrimethyl Ammonium Bromide (CTAB) extraction protocol from Gawel and Jarret (1991) with some modifications. Fresh leaves were ground to a fine powder in mortar and pestle in the presence of liquid nitrogen. Fifty mg of the powder was transferred to 1.5 ml Eppendorf® Safe-Lock microcentrifuge tube. A total of 900 μl of extraction buffer was added to each tube [100 mM Tris-HCL, 20mM of EDTA pH 8.0, 1.4 M of NaCl , 4% w/v CTAB , 2% w/v PVP K90 and 1% final volume of β-mercaptoethanol (added just before use)]. The mixture was homogenized using Hand Held Homogenizer (MRC Ltd). The mixture was vortexed for 1 min and then incubated for 45 min at 65 ºC in a water bath. After incubation tubes were centrifuged at a maximum speed of (14.000 rpm), the lysate from each tube was transferred into new 1.5 ml eppendorf tube, then 400 μl of chloroform-isoamylalcohol (24:1, v/v) was added and tubes were centrifuged for 15 min at 3000 rpm. After centrifugation the upper aqueous phase was transferred to QIAshredder spin columns to remove precipitate and cell debris, then tubes were centrifuged for 5 min at 14.000 rpm , equal volume of Isopropanol was added to the lysate and incubated over night at (-20 ºC ). The supernatant was discarded after centrifugation for 5 min at 14.000 rpm, and then DNA 15 pellets were rinsed with 50 μl of 70% cold ethanol and centrifuged for 3 min at 14.000 rpm. The supernatant was discarded and the pellets allowed to dry for 45 min, then resuspended in 50 μl TE buffer. RNase digestion was followed to remove RNAs from the solution, by addition 2 μl of RNase A and incubation for 1 h at 37 ºC. 2.4 PCR Amplification and Gel Electrophoresis The nuclear ribosomal DNA including the ITS regions (ITS-1 spacer, 5.8S rDNA and ITS-2 spacer) were amplified using universal primers (Fior et al., 2006). Primer sequences were ITS-1F (5'-TCC GTA GGT GAA CCT GCG GAA GGA TCA TTG-3') and ITS-4R (5'-TCC TCC GCT TAT TGA TAT GC-3'). The amplified PCR product was approximately 700 bp. Briefly, the PCR reaction was performed with a final volume of 25 μl containing 12.5 μl of PCR premix with MgCl2 (ReadyMixTM Taq PCR Reaction Mix with MgCl2, Sigma), 0.4 μM of each primer, 3μl (10.25 - 31.6 ng/ μl) of DNA template. The DNA amplification was performed with a thermal cycler (Mastercycler Personal, Eppendorf) using the following conditions: initial denaturation for 3 min at 94 ºC was followed by 35 cycles, each cycle consisting of denaturation at 94 ºC for 50 sec, annealing at 50 ºC for 50 sec and extension at 72 ºC for 2 min, with a final extension step at 72 ºC for 10 min. The PCR products were resolved by electrophoresis through 1.5 % agarose gel to determine the size of amplified fragment after ethidium bromide staining (0.5 μg/ml). 16 2.5 DNA Cleaning and Sequencing The amplified PCR products were cleaned using ChargeSwitch®-Pro PCR Clean-Up Kit (Invitrogen, USA), following the manufacturer's protocol. DNA PCR products were sequenced by dideoxynucleotide chain termination method using 3130 Genetic Analyzer (Applied Biosystems®, USA), Bethlehem University, Bethlehem, Palestine. The sequencing of PCR product was carried out with ITS-1F and ITS-4R primers used singly in forward and reverse reactions, respectively, and BigDye® Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems®, USA). Sequence information was submitted for accession number in primary bioinformatics web servers. 2.6 Sequence Alignment and Analysis The comparison of the continuous sequences of ITS region of Trifolium studied species was carried out with previously available sequences in GenBank using Blastn (Nucleotide Basic Local Alignment Search Tool) system. Multiple alignments were done using ClustalW of the computer program MEGA software (version 6). Phylogenetic analysis was based on alignments obtained from ClustalW of a 627 bp sequence. Phylogenetic tree was constructed using the Neighbor-Joining method in the same software. The robustness of the groupings in the Neighbor Joining analysis was assessed with 1000 bootstrap resembling. Reference sequences were retrieved from GenBank used for phylogenetic analysis and Salvia 17 candidissima was used as an out-group. Pair-wise distances were computed using the Kimura's 2-parameter method (K2-P). 18 Chapter Three Results 19 3.1 Morphological Characterization of Leguminosae Family 3.1.1. Classification of Leguminosae Family Kingdom: Plantae – Plants Subkingdom: Tracheobionta – Vascular plants Superdivision: Spermatophyta – Seed plants Division: Magnoliophyta – Flowering plants Class: Magnoliopsida – Dicotyledons Subclass: Rosidae Order: Fabales Family: Leguminosae The following description template was obtained from Flora Palaestina (Zohary, 1966a). 3.1.2. Description of the Leguminosae Family Herbaceous or woody plants, rarely creeping or climbing, sometimes spiny. Leaves alternate, rarely opposite, usually pinnate, 3-foliolate or digitate, sometimes terminating in or reduced to a tendril, rarely leaves simple; stipules usually present. Flowers hermaphrodite, in axillary or terminal racemes, panicles, heads or spikes, rarely solitary, zygomorphic. Calyx 5-, rarely 4-merous, with sepals more or less united at base, often 2-lipped. Corolla 5-merous, papilionaceous, consisting of a posterior, outermost petal (the standard), 2 lateral, often horizontal, petals (the wings) and 2 anterior and innermost ones usually united by their margins (the keel). Fruit usually 20 a 1-celled, many seeded pod (legume), dehiscing by 2 valves along the ventral and dorsal sutures. Seeds usually fairly large sometimes arillate. 3.1.3. Key the Studied Trifolium Species 1. Flowers yellow to pale yellow, standard flattish or spoon-shaped all along; calyx tube 5- nerved, calyx upper teeth much shorter than the three lower, throat open……………………………………………………1. T.campestre 1. Flowers white, pink or purple, standard oblong limbed, somewhat longer than wings; calyx tube 10- nerved, calyx teeth equal in length, throat open or not. 2. Flowers whitish or pink; calyx campanulate, densely subappresed- hispid, throat densely fleecy but not closed by a callosity. Stipules not membranous, dentate, not ending with cuspidate apex……..2. T.stellatum 2. Flowers pink or purple; calyx cylindrical, subappresed hirsute or appresed to patulous-hairy, throat closed by callosity or provided with hair ring. Stipules membranous, entire, ending with cuspidate apex. 3. Heads cylindrical. All leaves including upper most ones alternate. Flowers corolla longer than calyx; calyx subappresed hirsute, throat completely closed by a callosity ………………………3.T.purpureum 21 3. Heads ovoid. All leaves alternate except upper ones opposite. Flowers corolla as long as calyx; calyx appresed to patulous-hairy, throat provided by a hair ring…………………………………………………….....4.T.dasyur um 3.1.4. Description of the Clover Genus (Trifolium L.) and the Studied Species Annual or perennial herbs with erect, ascending or procumbent stems, sometimes with creeping rootstocks. Leaves with 3, rarely with 5 (or 7) dentate or entire leaflets; stipules partly connate and adnate to petiole, entire or rarely dentate. Racemes axillary or terminal, often head-like or spike-like or umbellate, pedunculate or sessile, many- rarely few-flowered, sometimes involucrate by free or connate bracts. Flowers pedicellate or sessile, bracteate or not, all or rarely only the outer (lower) flowers fertile. Calyx mostly tubular or campanulate, 5, 10-20(rarely30-36) - nerved, with 5 equal or unequal teeth; sometimes calyx 2-lipped, with upper teeth often shorter or longer and partly connate at base; throat of calyx open or closed by a callosity or by a ring of hairs; tube of calyx sometimes inflated in fruit. Corolla persistent, marcescent or caduceus, white, yellow, purple; pink, fresh -coloured, lilac, violet or 2-coloured; standard free or connate at base with wings and keel; the latter two sometimes connate with one another and mostly adnate to the stamens; wings often longer than keel. Pod indehiscent, mostly 1-2 (rarely 4-8)-seeded, enclosed in the persistent calyx and sometimes also in the persistent corolla, rarely exserted, usually 22 membranous, rarely leathery, ovoid to oblong or linear. Seeds globular to ovoid and oblong, sometimes reniform or lenticular. 3.1.4.1 Trifolium campestre Schreb. In Sturm, Deutschl. F1.1, 16: t.253 (1804). T.agrarium L., Sp.P1772 (1753) p.p.; Boiss., F1. 2: 153(1872) p.p T. procumbens L., F1. Suec.ed. 2, 261 no. 673 (1755) p.p. non L., Sp. P1. 772 (1753); Boiss., 1.c. 154 p.p.(Zohary, 1966a) [ Plate 1]. Annual, hairy or almost glabrous, 10-30 cm. Stems erect, ascending or prostrate, simple or branched. Leaves petiolate; stipules herbaceous, ovate to oblong, long- acuminate; leaflet 0.8-1.6 x 0.4-0.8 cm., ovate to oblong – elliptical, often with cuneate base, truncate or retuse at apex, denticulate in upper half; terminal leaflet long- petioluate. Peduncles as long as or longer or shorter then leaves. Heads 0.8-1.3 X0.7-1 cm., many flowered, often globular. Pedicels shorter than calyx, becoming deflexed early. Flowers rather dense, later becoming imbricated. Calyx white, 5- nerved, glabrous or rarely slightly hairy; tube membranous; the 2 upper teeth very short, triangular or lanceolate, the others about twice as long as tube or longer, long-subulate. Corolla (4-) 5- 6 (-7)mm., yellow to pale yellow, turning brown in fruit; standard 4-5mm., with orbicular limb, flat or spoon-shaped, denticulate at margin, many-nerved. FI. February-April (-October). Area: Mediterranean, with extensions into the Euro-Siberian and Irano- Turanian regions. Habit: Fields, Al-bitaha' roadsides. Al-Jalīl, Akka Plain, The Western Central Plains of Palestine, Palestinian Plain, Al Jaleel Al A'alaa Mt., 23 Kurmul Mt., Marj Ibn Amir Plain, Mt. Faqqua, Nablus, Hebron Mts., An- Naqab, Tell el-Qadi, Al-Hula Plain, Al-Qhor, Beesan Valley, Gilead, Ammon, Mo'ab. Common. Distribution: Tulkarem, Kufur Qud, Road to Ramallah, Nablus –bit wazn [Plate3]. 3.1.4.2 Trifolium stellatum L. Sp. P1.769 (1753); Boiss., F1. 2:121 (1872). (Zohary, 1966a) [Plate1]. Annual, patulous and soft-villose, 10-20 cm. Stem few, mostly erect or ascending, sparsely branched or unbranched. Leaves long-petioled; stipules membranous, ovate, obtuse, dentate, green at margin; leaflets mostly 5-8 X 4-8 mm., obcordate with cuneate base, dentate in upper part . Heads 1.5-2 cm., long-peduncled, many- flowered, broadly obovoid to globular. Flowers 1.5-1.8 cm., loose. Calyx campannulate, densely subappressed- hispid, 10-nerved; tube shorter than the lanceolate- subulate teeth, the latter somewhat connate at base; throat densely fleecy but not closed by a callosity. Corolla mostly shorter than or as long as, rarely somewhat longer than calyx teeth, white or pink; standard with ovate to oblong limb, slightly longer than wings. Fruiting calyx with a long and sharp-pointed base; teeth spreading, broadened at base, with bristles directed upwards. Pod short- stipitate, membranous, lanceolate to pear-shaped. Fl. February-April Area: Mediterranean, with slight extensions into adjacent regions. 24 Habit: Roadsides, fields and Al-bitaha'., Akka Plain, The Western Central Plains of Palestine, Palestinian Plain, Al Jaleel Al A'alaa Mt., Kurmul Mt., Marj Ibn Amir Plain, Mt. Faqqua, Nablus, Wadi Al- Khalil, Hebron Mts., Tell el-Qadi, Al-Hula Plain, Al-Qhor, Gilead, Ammon, Mo'ab. Distribution: Jenin, Road to Ramallah [Plate3]. 3.1.4.3 Trifolium purpureum Loisel., F1. Gall 484, t.14 (1807). (Zohary, 1966a) [Plate2]. Annual, mostly appressed- to subappressed- hirsute, 10- 30 (-50) cm. Stems few or many, erect, ascending or rarely procumbent, branching above, striate. Leaves with petioles shortening towards apex of stem, stipules 1- 1.5cm., membranous between nerves, oblong- lanceolate, with upper portion subulate; leaflets 2-4(-6) X 0.2-1 cm., oblong- lanceolate to linear or ellipictal, acute, mucronulate, obscurely toothed above, mostly hairy only at margins. Heads (1- ) 1.5-6 cm., at the end of dichotomous or simple branches, conical or ovoid in flowers, ovoid- oblong to cylindrical in fruit. Flowers 1.5-2 cm. Calyx up to 1 cm., subappressed- hirsute; tube 3mm. or more, almost cylindrical; teeth subulat, the lowermost tooth longer than calyx, slightly longer than to twice as long as the rest. Corolla distinctly longer than calyx, purple above, whitish- lilac below, sometimes lilac or whitish all over ; standard with oblong limb distinctly longer than wings. Fruiting calyx tube obconical, prominently nerved; teeth blunt, divergent or spreading, plumose, with bristles arising from tubercle; throat completely closed by callosity. Seeds about 1mm., ovoid, brown. F1. February-May 25 Area: Mainly Mediterranean, with extensions into adjacent W. Irano- Turanian and Euro-Siberian regions. Habit: Fields, Al-bitaha' and roadsides. Al-Jalīl, Akka Plain, The Western Central Plains of Palestine, Palestinian Plain, Al Jaleel Al A'alaa Mt., Kurmul Mt., Marj Ibn Amir Plain, Mt. Faqqua, Nablus, Wadi Al –Khalil , Hebron Mts., An-Naqab, Tell el-Qadi, Al- Hula Plain, Al-Qhor, Beesan Valley, Gilead, Ammon. Common. Distribution: Jenin, Kur Qud, Road to Ramallah, Tulkrem. [Plate3] 3.1.4.4 Trifolium dasyurum C. Presl, Sumb. Bot. 1:53 t.33 (1832). T.formosun Urv., Mem. Soc. Linn. Paris 1: 350 (1822) non Savi, Obs. Trif. 102 (1810) nec Curt. Ex DG., Prodr. 2: 200 (1825); Boiss., F1. 2: 124 (1872). T.formosun Uvar. Var. minus Post, F1 Syr. Pal. Sin. 236 (1883- 1896) et ed. 2, 1: 338 (1932). T. velivolum Paine, Palest. Explor. Soc. Statement 3: 103 (1875). (Zohary, 1966a) [Plate2]. Annual, appressed- or antrorsely pubescent, 10-30(-40) cm. Stems few or many, ascending, diffuse, often dichotomously branching above, striate. Both branches of each fork, or only one of them, developed and ending with a head. Leaves opposite (when only one branch of the fork develops),petiolate, uppermost leaves subsessile; stipules membranous, inflated, with arcuate nerves and a long, subulate to cuspidate tip; leaflets 1-305 X0.2-1 cm., elliptical to oblong, acute, not dentate or obscurely so. Heads 1.5-3 (-4) cm., many-flowered, ovoid. Calyx appressed- to patulous- hairy; tube cylindrical to obconical; teeth about twice as long as tube, 26 equal, subulate, truncate, with lanceolate base. Corolla about as long as calyx, purple above, whitish or pink below; standard with oblong limb, somewhat longer than wings. Fruiting calyx with top-shaped tube, divergent or spreading teeth and closed throat. Seeds smooth about 1.8mm. F1.March-May Area: E. Mediterranean, with extensions into adjacent territories of the Irano-Turanian region. Habit: Roadsides and fallow fields. Al-Jalīl, The Western Central Plains of Palestine, Palestinian Plain, Al Jaleel Al A'alaa Mt. Kurmul Mt., Marj Ibn Amir Plain, Mt. Faqqua, Nablus, Wadi Al-Khalil, Hebron Mts., An-Naqab, Tell el-Qadi, Al- Hula Plain, Al-Ghor, Gilead, Ammon, Common. Distribution: Jericho /Wdi Al-Qalt. [Plate3]. 27 Plate 1: Colored photographs of the studied species A. Trifolium campestre B. Trifolium campestre C. Trifolium stellatum D. Trifolium stellatum 28 Plate 2: Colored photographs of the studied species A. Trifolium purpureum B. Trifolium purpureum C. Trifolium dasyurum D. Trifolium dasyurum 29 Plate 3: Map of Palestine showing the distribution of the studied species Trifolium campestre Trifolium purputeum Trifolium dasyurum Trifolium stellatum 30 3.2. Molecular Characterization of the Studied Trifolium Species 3.2.1 Obtained DNA Extract Quantity and Quality of Investigated Trifolium Species. Table 3.1: DNA Extract Quantity and Quality of the studied species. No.of sample Plant Species sample OD260 260/280 (Purity) ng/ μl (DNA concentration) 1. T.purpureum 0.344 1.442 17.2 2. T.purpureum 0.289 1.323 14.45 3. T.purpureum 0.408 1.65 20.4 4. T.purpureum 0.216 1.126 10.8 5. T.purpureum 0.326 1.4 16.3 6. T.campestre 0.208 1.134 10.25 7. T.campestre 0.205 1.064 10.25 8. T. stellatum 0.398 1.75 20 9. T. stellatum 0.316 1.414 15.8 10. T. stellatum 0.218 1.276 11 11. T. dasyurum 0.632 1.47 31.6 12. T. dasyurum 0.419 1.6 21 3.2.2 Agarose Gel Electrophoresis Analysis for the Amplified ITS Sequences Specific sites of nuclear ribosomal DNA (ITS-1 spacer, 5.8S rDNA, ITS-2 spacer) of the studied species were amplified using ITS-1F and ITS-4R primers. The amplified PCR products for all studied species gave a single band with approximately 700 bp (Figure 3.1). 31 Figure 3.1: Agarose gel electrophoresis analysis showing detection of amplified ITS regions of different species of Trifolium. Lane L: 100-bp DNA ladder; lanes1-5: T.Purpurem; lanes 6-7: T.campestre; lanes, 8-10: T.stellatum; lanes, 11-12: T.dasyurum; lane NC: negative control. 3.2.3 Genetic Relationship among Closely Related Species of the Clover Genus (Trifolium- Leguminosae) Sequences of nrDNA ITS (≈ 700 bp) were obtained from 12 classified plant leaf samples that belong to the Clover genus (Trifolium). Afterwards phylogenetic tree was constructed according to the similarity among Trifolium species, where the bootstrap was inferred 1000 replicates. All DNA ITS sequences of the examined species were deposited at the GeneBank database under the accession numbers (MF589956-MF589967). Table 2.2 shows the Voucher number and GeneBank no. for all studied species samples. 32 The resulted phylogenetic tree demonstrates the relationship among the studied closely related species and their related species of clover genus retrieved from the GeneBank. Whereas, evolutionary DNA distances between ITS region sequences were computed using the K2-P method for the studied closely related Trifolium Species and other species retrieved from the GeneBank (Figure 3.2, Table 3.2 respectively). Two main clades (I, II) appeared in the phylogenetic tree according to ITS sequences analysis. Clade I contains two sub-clades (Ia, Ib). Sub-clade (Ia) includes sequences of ITS regions for T.purpurem and T.dysurum and their closely related species. Whereas, clade II contains two sub-clades (IIa, IIb). Sub-clade (IIa) include T.stellatum and its closely related species, but, sub- clade (IIb) includes T.campestre and its closely related species. The presence of T.purpurem (MF589956, MF589957, MF589958, MF589959, MF589960), T.daysurum (MF589966, MF589967) and the species that were retrieved form GeneBank T.purpurem (DQ312140), T.daysurum (DQ312040) in the same clade I (sub-clade Ia), showed that they are identical species, since they have 0% bp differences (Table 3.2). Moreover, T.purpurem and T. dasyurum form a sister group to T.angustifolium, T.dichroanthum and T.prophetarum (DQ312200.1, DQ312044.1 and DQ312206.1 respectively) (Figure 3.2). In clade II, sub-clade (IIa) shows that T.stellatum (MF589963, MF589964, MF589965) are closely related to T.incarnatum which was retrieved GeneBank (AF053160.1). In the phylogenetic tree, sub-clade (IIb) shows 33 that T.campestre (MF589961, MF589962) and T.grandiflorum which was retrieved from GeneBank (DQ312062.1) are identical species, since they have identical ITS sequence (0% bp differences) (Table 3.2). In addition, based on the phylogenetic tree and on the resulted base pair difference data (Table 3.2), T.boissieri (DQ312017.1) is related to both T. campestre and T.grandiflorum, since they have 1% bp differences (Table 3.2). Those three species form a sister group to T. glanduliferum (DQ312056) as illustrated in the phylogenetic tree. However, S. candidissima was found to be quite divergent and did not fall in any of the major clusters as illustrated (Figure 3.2). 34 Fig 3.2: Phylogenetic analysis by Neighbor-Joining method based on ITS region sequences. Sequences of Trifolium L. species (T.purpurem, T.dasyurum, T.campestre and T.stellatum) denoted by asterisk represent the studied samples. Other reference sequences species used for phylogenetic analysis were retrieved from GeneBank. Salvia candidissima was used as an out - group. Bootstrap consensus tree was inferred from 1000 replicates. 36 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 1.Trifolium_purpureum_(MF589956)** 2.Trifolium_purpureum_(MF589957)** 0.00 3.Trifolium_purpureum_(MF589958)** 0.00 0.00 4.Trifolium_purpureum_(MF589959)** 0.00 0.00 0.00 5.Trifolium_purpureum_(MF589960)** 0.00 0.00 0.00 0.00 6.Trifolium_campestre_(MF589961)** 0.10 0.10 0.10 0.10 0.10 7.Trifolium_campestre_(MF589962)** 0.10 0.10 0.10 0.10 0.10 0.00 8.Trifolium_stellatum_(MF589963)** 0.08 0.08 0.08 0.08 0.08 0.11 0.11 9.Trifolium_stellatum_(MF589964)** 0.08 0.08 0.08 0.08 0.08 0.11 0.11 0.00 10.Trifolium_stellatum_(MF589965)** 0.08 0.08 0.08 0.08 0.08 0.11 0.11 0.00 0.00 11.Trifolium_dasyurum_(MF589966)** 0.00 0.00 0.00 0.00 0.00 0.10 0.10 0.08 0.08 0.08 12.Trifolium_dasyurum_(MF589967)** 0.00 0.00 0.00 0.00 0.00 0.10 0.10 0.08 0.08 0.08 0.00 13.Trifolium_glanduliferum_(DQ312056) 0.07 0.07 0.07 0.07 0.07 0.09 0.09 0.08 0.08 0.08 0.07 0.07 14.Trifolium_incarnatum_(AF053160) 0.08 0.08 0.08 0.08 0.08 0.10 0.10 0.03 0.03 0.03 0.08 0.08 0.07 15.Trifolium_campestre_(DQ312025) 0.10 0.10 0.10 0.10 0.10 0.00 0.00 0.11 0.11 0.11 0.10 0.10 0.09 0.10 16.Trifolium_stellatum_(DQ312165) 0.09 0.09 0.09 0.09 0.09 0.11 0.11 0.00 0.00 0.00 0.09 0.09 0.08 0.03 0.11 17.Trifolium_boissieri(DQ312017) 0.10 0.10 0.10 0.10 0.10 0.01 0.01 0.12 0.12 0.12 0.10 0.10 0.09 0.11 0.01 0.12 18.Trifolium_grandiflorum_(DQ312062) 0.10 0.10 0.10 0.10 0.10 0.00 0.00 0.11 0.11 0.11 0.10 0.10 0.09 0.10 0.00 0.11 0.01 19.Trifolium_dasyurum_(DQ312040) 0.00 0.00 0.00 0.00 0.00 0.10 0.10 0.09 0.09 0.09 0.00 0.00 0.07 0.07 0.10 0.08 0.10 0.10 20.Trifolium_prophetarum_(DQ312206) 0.04 0.04 0.04 0.04 0.04 0.11 0.11 0.09 0.09 0.09 0.04 0.04 0.07 0.07 0.11 0.08 0.12 0.11 0.03 21.Trifolium_angustifolium_(DQ312200) 0.02 0.02 0.02 0.02 0.02 0.10 0.10 0.08 0.08 0.08 0.02 0.02 0.06 0.06 0.10 0.07 0.10 0.10 0.02 0.02 22.Trifolium_purpureum_(DQ312140) 0.00 0.00 0.00 0.00 0.00 0.10 0.10 0.09 0.09 0.09 0.00 0.00 0.07 0.07 0.10 0.08 0.10 0.10 0.00 0.03 0.02 23.Trifolium_dichroanthum_(DQ312044) 0.02 0.02 0.02 0.02 0.02 0.10 0.10 0.08 0.08 0.08 0.02 0.02 0.07 0.07 0.10 0.08 0.11 0.10 0.02 0.03 0.01 0.02 24.Salvia_candidissima_(DQ667261) 0.42 0.42 0.42 0.42 0.42 0.47 0.47 0.45 0.45 0.45 0.42 0.42 0.44 0.44 0.46 0.45 0.46 0.46 0.41 0.42 0.42 0.41 0.42 Table 3.2. Genetic differences between ITS region sequences obtained from the studied Trifloium species (donated by asterisk) and those retrieved from the GeneBank. The evolutionary DNA distances were compound using K2P method. 37 Chapter Four Discussion 38 4.1 Taxonomy of Trifolium Classification of Trifolium depends on essential morphological characters such as calyx, corolla, and others. Even in spite of the fairly unmodified pods in the species of that genus, sometimes they can be reliable for their identification and classification. An elaborated taxonomical review on the genus Trifolium was carried out by Hossain on 1961. In his review he subdivided this genus in to eight subgenera. Nevertheless, an important comprehensive study on the genus Trifolium revealed in the nomenclature of these eight subgenera by sections (Zohary and Heller, 1984). Those sections are: Lotoidea, Paramesus, Mystillus, Vesicaria, Chronosemium, Trifolium, Tricocephalum and Involucrarium. Although many differences are recognized among the members of the considered sections, the only character that they shared in, is the adnate claws of wings and keel to the staminal bundle (Hossain, 1961). Species of the section Chronosemium (T.campestre, T.boissieri, and T.grandiflorum) are characterized by some common and uncommon morphological features to those in section Paramesus (T.glanduliferum). In the current study, they were shown to be sister groups in the same clade II/ sub-clade IIb in the constructed phylogenetic tree (Figure 3.1). However, a unique feature to the species of the section Paramesus in having glands on their stipules tips may be considered the reason for their classification to separate sections rather than one. This molecular ITS evidence in this study coincides with the taxonomical debate of Hossain (1961) regarding those taxa. 39 Morphological characters of T.campestre illustrate that it is closely related to T.boissieri. The only different character between these two species is the shape of the corolla standard. In T.campestre the standard is usually flattish or spoon-shaped all along, whereas it is spoon-shaped from above only in T.boissieri. The resulted 1% bp difference (Table 3.2) and their possion in the same clade II/ sub-clade IIb in the constructed phylogenetic tree (Figure 3.1) support that both T.campestre and T.boissieri could be actually considered related two species. An outstanding information was obtained from the alignment of T.campestre ITS sequence in the GeneBank using Blastn, that T.grandiflorum has an identical ITS sequence, as they both have 0% bp difference (Table 3.2). Based on the observed morphological characters of T.grandiflorum (Flora of Israel Online, 2006+), the only difference was the petals color as being pink in T.grandiflorum and yellow in T.campestre. Since, different phenotypes, for example different flower colors can't be considered as different genotypes (Zohary, 1987). This can be confirmed by that the genetic mechanisms controlling floral features are apparently unstable, resulting in fluctuating asymmetry (Friesen et al., 1997). So a direct relation between the phonetic and genetic variation indeed can't be easily established (Treu et al., 2001). Therefore, T.campestre and T.grandiflorum could be regarded taxonomically as one species. The section Trifolium (T.purpurem, T.dasyurum, T.stellatum, T.angustifolium and T.dichroanthum… etc.) contains the largest species number of the genus Trifolium. The ITS sequence analysis of T.purpurem 40 and T.dasyurum showed that they are identical species, since they have 0% bp difference (Table 3.2), and were clustered together in clade I/ sub-clade Ia in the constructed phylogenetic tree (Figure 3.2). This coincides with the high resemblance of their morphological characters. However, the arrangement of their leaves was the reason after distinguishing them as two different species. All leaves including the uppermost ones are alternate in T.purpurem, while opposite in T.dasyurum. This is consistent with a previously conducted study on T.purpurem and T.dasyurum, using ITS and other marker (chloroplast trnL). The recorded results revealed the same out finding that T.purpurem and T.dasyurum are identical ones (Ellison et al., 2006). Subsequently, from the previous taxonomical and bioinformatics evidences, T.purpurem and T.dasyurum could be classified as the same species. Another three closely related species of the section Trifolium T.angustifolium, T.dichroanthum and T.prophetarum (sub-clade Ib) can be considered as sister group to the other closely related species T.purpurem and T.dasyurum (sub-clade Ia) since they all were grouped in the same clade I. This goes along with similarities and some differences among them in their morphological characters. For example T.purpurem and T.angustifolium differ in the exertion of corolla as it is highly exerted in T.purpurem, while hardly exerted in T.angustifolium. Another morphological difference is observed in T.dichroanthum from T.purpurem, in that the former has two colored petals, but uniform color in T.purpurem. Moreover, T.prophetarum (sub-clade Ib) differs from T.dasyurum (sub- 41 clade Ia) in that the petals in the former are longer than calyx but as long as calyx in the latter. In addition, the constructed phylogenetic tree (Figure 3.2) revealed the close relationship between T.stellatum (sub-clade IIa) of the section Trifolium to T.glanduliferum which is in the section Paramesus (sub-clade IIb) as they were positioned in the same clade II. Their separation in two sub-clades may probably refer to the presence of glands on the stipules in T.glanduliferum while their absence in T.stellatum. This ITS sequence analysis result confirms the morphological discrimination between these two species by Zohary and Heller (1984). 4.2 Optimization of Plant DNA Extraction Having high quality of DNA is mandatory for all DNA experimental procedures. All plant DNA extraction protocols include the same basic steps of disruption of the cell wall, cell membrane and nuclear membrane to release the DNA, followed by its precipitation (Moreira and Oliveira, 2011). Biomolecules such as proteins, polysaccharides, phenols and other secondary metabolites have to be removed from the samples to guarantee that the extracted DNA is pure. Basic protocols for DNA extraction include using Sodium Dodecyl Sulfate (SDS), Cetyltrimethyl Ammonium Bromide (CTAB) and commercially plant DNA extraction Kits. 42 Firstly standard Qiagen DNeasy plant mini kit (Qiagen, Crawley, UK) protocol was used. The DNA quantity and quality were evaluated using spectrophotometer NanoDrop (Genova Nano Spectrophotometer). The DNA quantity was investigated by recording the absorbance at 260 nm. The DNA concentration in most samples was in the range of 18.9 - 52.8 ng/μl. However, the quality of DNA was detected by the ratio of the absorbance at 260 and 280 nm (A260/A280 ratio) (Sambrook et al., 1989).The obtained DNA quality of the examined samples was in the range of 0.027 - 0.109. Therefore, due to that obtained low DNA quality and quantity, slight modification on Qiagen DNeasy plant mini kit protocol was carried out. The lysis incubation time was prolonged from 10 min to 1 h, to increase the DNA quantity. However, the conducted previous modification did not achieve any pronounced enhancement in that. Therefore, Lefort and Douglas (1999) manual CTAB DNA extraction protocol was followed with minor modifications in increasing lysis time and reducing the final TE buffer volume in which the DNA was dissolved. For example, the extracted DNA of T.stellatum was of good quantity (56.1 ng/ μl) as well as good quality (260/280 ratio = 1.79). However, still no PCR products were obtained. As a result, it was concluded that the presence of polysaccharides or polyphenols, could be a major inhibitor of having PCR products. So to overcome this conflict, increasing the concentration of both CTAB and NaCl salt was necessary to precipitate pure nucleic acids (Barnwell et al., 1998). In addition, to have efficient plant cell lysis, they were homogenized 43 with CTAB lysis buffer using Hand Held Homogenizer (MRC Ltd). Adding to that, QIAshredder spin columns were used to ensure extracted DNA more purified from polysaccharides or polyphenols. Those DNA extracts resulted in positive PCR products, which were subjected to further analysis in this study. Conclusions and Recommendations Reliable evolutionary relationships construction among different organisms could depend on the DNA sequence analysis rather than the traditional taxonomic tools. Moreover, the molecular markers could be beneficial for identifying the specimens that don't have one or more essential parts like flowers, fruits…. etc, as in the case of plants. The out findings in this study have proved that ITS sequencing is an effective method for identifying different Trifolium species and the construction of phylogenetic tree illustrating the relationship among them. Therefore, some of the conflicts in the traditional taxonomy of Trifolium were resolved in this study. Based on this study, it is recommended to identify both T.purpurem and T.dasyurum as same species. Accordingly depending on the nomenclature rules T.dasyurum (1832) can be considered as synonym to T.purpurem (1807), which can be referred as the valid name of that species. Similarly this can be applied to both T.campestre (1804) and T.grandiflorum (1767). 44 The former could be regarded as synonym to T.grandiflorum which could be taken as the valid name. In addition, the current conducted traditional morphological and molecular taxonomical study is the first of its type that was able to highlight the phylogenetic relationship among some closely related species of the genus Trifolium in Palestine/West Bank. This paves the way for future in-depth researches on more different species of the same genus. In addition, using other molecular markers could reveal more clarification of the taxonomy of Trifolium different species. 45 References 1. Akman Y., (1982). Climats et bioclimats méditerranéens en Turquie. Ecol. Mediterr.; 8: 73-87. 2. Akman Y., (1999). Climate and Bioclimats ( Bioloclimatic Methods and Climates of Turkey). Kariyer Press. Ankara, Turkey. 350 p. 3. Ali-Shtayeh M.S., and Jamous R.M., (2002). Red list of threatened plants‖ of the West Bank and Gaza Strip and role of botanic gardens in their conservation. Biodiversity. Environ. Sci. Stud. Ser.; 2: 1-46. 4. Ali-Shtayeh M.S., and Jamous R.M., (2003). Educational and research BERC - Til botanic gardens Newsletter. Biodiversity and Environmental Research Center (BERC), Til, Nablus, Palestine. 16 p. 5. Alvarez I., Wende J. F., (2003). Ribosomal ITS sequences and plant phylogenetic inference. Mol. Phylogenet. Evol.; 29: 417–434. 6. Applied Research Institute- Jerusalem (1997) Flora Database. 7. Barnwell P., Blanchard A.N., Bryant J.A., and Smirnoff N., (1998). Isolation of DNA from the highly mucilaginous succulent plant Sedum telephium. Plant Mol. Biol. Rep.; 16: 133-138. 8. Boissier E., (1873). Trifolium In: Flora Orientalis. Genevae et Basileae. 2: 110-156. 46 9. Caradus J.R., (1995). Frost tolerance of Trifolium species. New Zeal. J. Agr. Res.; 38: 157-162. 10. Crespo D., (1997). Pastagens Extensivas do Sudoeste de la Península Ibérica: Producir Mais Conservando Melhor. Actas de la XXXVII Reunión Científica de la SEEP (Sevilla-Huelva). 163-182. 11. Danin A., (2004). Distribution Atlas of Plants in the Flora Palaestina Area. 2 nd Edn., Israel Academy of Sciences and Humanities, Jerusalem, ISBN: 9652081671. 520 p. 12. Danin A., (eds.) (2006+). {Continuously updated}, Flora of Israel online. The Hebrew University of Jerusalem, Jerusalem, Israel. Published at http://flora.org.il/en/plants/. 13. Davis S.D., Heywood V.H., Hamilton A.C., (eds.) (1994). Centers of Plant Diversity. A guide and strategy for their conservation. Volume 1: Europe, Africa, South West Asia and the Middle East. Xiv+578. WW- IUCN. Publ. Unit, Cambridge-UK. 14. Dothan F.N., (1978a). Flora Palaestina. Plates Ericaceae to Compositae. Israel Academy of Sciences and Humanities, Jerusalem. 3: 757 p. 15. Dothan F.N., (1978b). Flora Palaestina. Text Ericaceae to Compositae. Israel Academy of Sciences and Humanities, Jerusalem. 3: 481 p. http://flora.org.il/en/plants/ 47 16. Dothan F.N., (1986a). Flora Palaestina. Plates Alismataceae to Orchidaceae. Israel Academy of Sciences and Humanities, Jerusalem. 4: 525 p. 17. Dothan F.N., (1986b). Flora Palaestina. Text Alismataceae to Orchidaceae. Israel Academy of Sciences and Humanities, Jerusalem. 4: 462 p. 18. Dothan F.N., and Danin A., (1991). Analytical Flora of the Wild Plants Eretz Israel. Cana Publishing House Ltd., Jerusalem. 1040 p. 19. Doyle J.J., (1995). DNA data and legume phylogeny: a progress report. In: Crisp M., Doyle J. J. (eds.). Advances in Legume Systematics, Part 7: Phylogeny. Royal Botanic Gardens, Kew. 11–30. 20. Ellison N. W., Liston A., Steiner J. J., Williams W. M., and Taylor N. L., (2006). Molecular phylogenetics of the clover genus (Trifolium—Leguminosae). Mol. Phylogenet. Evol.; 39(3): 688-705. 21. Fior S., Karis P.O., Casazza G., Minuto L., Sala F., (2006). Molecular phylogeny of the Caryophyllaceae (Caryophyllales) inferred from chloroplast matK and nuclear rDNA ITS sequences. Am. J. Bot.; 93(3): 399-411. 22. Friesen N., Fritsch R. and Bachmann K., (1997). Hybrid Origin of some Ornamentals of Allium subgenus Melanocrommyum Verified with GISH and RAPD. Theor. Appl. Genet.; 95:1229-1238. 48 23. Gawel N.J., Jarret R.L., (1991). A modified CTAB DNA extraction procedure for Musa and Ipomoea. Plant Mol. Biol. Report.; 9: 262-266 . 24. Ghariani S., Trifi-Farah N., Chakroun M., Marghali S., Marrakchi M., (2003). Genetic diversity in Tunisian perennial ryegrass revealed by ISSR markers. Genet. Resour Crop. Ev.; 50: 809–815. 25. Greuter W., (1991). Botanical Diversity, Endemism, Rarity and Extinction in the Mediterranean Area: An Analysis Based on the Published Volumes of Med-Checklist, Bot, Chron.; 10: 63-79. 26. Heyn C.C., (1981). Trifolieae. In: Polhill, R.M., Raven, P.H. (Eds.), Advances in Legume Systematics, Part 1. Royal Botanic Gardens, Kew, UK. 383–385. 27. Heywood V., (1995a). The Mediterranean Flora in the context of world Diversity. Ecol. Mediterr.; 21: 11-18. 28. Heywood V., (1995b). Global biodiversity assessment. Cambridge University Press, Cambridge, UK. 1140 p. 29. Heywood V., (2003). The future of floristics in the Mediterranean Region. Isr. J. Plant Sci.; 50: S-5-S13. 30. Hossain M., (1961). A revision of Trifolium in the Nearer East. Notes Roy. Bot. Gard. Edinburgh.; 23: 387–481 . 49 31. Hu J., Lavin M., Wojciechowski M., Sanderson M., (1999). Phylogenetic systematics of the tribe Millettieae (Leguminosae) based on trnK/matK sequences and its implications for evolutionary patterns in Papilionoideae. Amer. J. Bot.; 87: 418–430. 32. ILDIS [Internet]. (1999). International Legume Database and Information System. http://www.ildis.org/. 33. Lavin M., Doyle J. J., Palmer J. D., (1990). Evolutionary significance of the loss of the chloroplast-DNA inverted repeat in the Leguminosae. Evol.; 44: 390–402. 34. Lefort F., Douglas G.C., (1999). An efficient micro-method of DNA isolation from mature leaves of four hardwood tree species Acer, Fraxinus, Prunus and Quercus. Ann. For. Sci.; 56: 259–263. 35. Lewis G., Schrire B., MacKinder B., Lock M., (2005). Legumes of the World. Royal Botanic Gardens, Kew, UK. 14: 577. 36. Linnaeus C., (1753). Species Plantarum. 2:764-772. Stockholm. Facsimile ed. 1957, Royal Society, London . 37. Liston A., Wheeler J. A., (1994). The phylogenetic position of the genus Astragalus (Fabaceae): evidence from the chloroplast genes rpoC1 and rpoC2. Biochem. Syst. Ecol.; 22: 377–388 . 38. Lojacono M., (1883). Clavis specierum Trifoliorum. Nuova Gironale. Bot. Ilal.; 15: 225-278. http://www.ildis.org/ 50 39. McKey D., (1994). Legumes and nitrogen: the evolutionary ecology of a nitrogen-demanding lifestyle. In: Sprent JL & McKey D (Eds) Advances in Legume Systematics: Part 5 - The Nitrogen Factor 211–228. Royal Botanic Gardens, Kew, England. 40. Moreira P.A., and Oliveira D.A., (2011). Leaf age affects the quality of DNA extracted from Dimorphandra mollis Fabaceae, a tropical tree species from the Cerrado region of Brazil. Genet. Mol. Res.; 10: 353-358. 41. Myers N., (2003). Biodiversity hotspots revisited. BioScience.; 53: 916-617. 42. Myers N., Mittermeier R.A., Mittermeier C.C., Fonseca G.A.B., and Kent J., (2000). Biodiversity hotspots for conservation priorities. Nat.; 403:853-858. 43. Nickrent D., Patrick J., (1998). The Nuclear Ribosomal DNA Intergenic Spacers of Wild and Cultivated Soybean Have Low Variation and Cryptic Subrepeats. Genome; 41: 183-191. 44. Patwardhan A., Ray S., Roy A., (2014). Molecular Markers in Phylogenetic Studies – A Review. J Phylogenetics Evol Biol.; 2:131. 45. Penteado M., Garcia P., Perez M., (1996). Genetic Variability and Mating System in Three Species of the Genus Centrosema. Heredity; 87: 124-130. 51 46. Piano E., Francis C., (1993). The Future of Lucerne: Biotechnology, Breeding and Variety Constitution: Proceedings of the 10th International Conference of the EUCARPIA Medicago spp Group. Italy: Istituto Sperimentale per le Colture Foraggere. 514 p. 47. Planco C., Perez M., (1997). Intergenic Ribosomal Spacer Variability in Hexaploid Oat Cultivers and Landraces. Heredity; 78: 115- 123. 48. Polhill R. M., (1981). Papilionoideae. In: Polhill R. M., Raven P. H. (eds.) Advances in Legume Systematics, Part 1: 191–208. Royal Botanic Gardens, Kew, UK. 49. Poluuin O., Huxley A., (1967). Flowers of the Mediterranean. Chatto and Winddus Itd: London. 1 st Edition, 55-68. 50. Poyraz İ. E., Sözen E., Ataşlar E., Poyraz İ., (2012). Determination of genetic relationships among Velezia L. (Caryophyllaceae) species using RAPD markers. Turk. J. Biol.; 36: 293–302. 51. Presl C. B., (1832). Trifolium. In: Symbolae Botanica. Sumpt. Auctoris.; 1: 44-50. 52. Rundel P. W., (1989). Ecological success in relation to plant form and function in the woody legumes. Advances in Legume Biology, Monogr. Syst. Bot. Missouri Bot. Gard.; 29:377-398. 52 53. Sambrook J., Fritsch E.F., and Maniats T., (1989). Molecular Cloning: a Laboratory Manual (No.Ed.2). Cold Spring Harbor Laboratory Press, New York. 54. Sanderson M. J., Liston A., (1995) .Molecular phylogenetic systematics of Galegeae, with special reference to Astragalus. Advances in Legume Systematics: Part 7: Phylogeny. Royal Botanic Gardens, Kew, UK; 331–350. 55. Sanderson M. J., Liston A., Wojciechowski M. F., (1996). Diversification rates in a temperate legume clade: are there ―so many species‖ of Astragalus (Fabaceae). Amer. J. Bot.; 83: 1488–1502. 56. Seringe N.C., (1825). Trifolium. In: de Candolle A.P., Prodr. (DC.); 2: 189-207. 57. Steele K. P., Wojciechowski M. F., (2003). Phylogenetic analyses of tribes Trifolieae and Vicieae, based on sequences of the plastid gene matK (Papilionoideae: Leguminosae). Advances in Legume Systematics, 10: 355-370. 58. Steiner J. J., Robinson W. A., Liston A., Taylor N. L., (1997). ITS and RAPD phylogenetic hypotheses and the ecological distributions of North American Trifolium L. (Fabaceae). Amer. J. Bot.; 84:235–236. 59. Sprent J. I., (2001). Nodulation in legumes (1-13). R. B. Gardens (Ed.). Kew: Royal Botanic Gardens. 53 60. Taşkın B. G., Vardareli N., Doğaç E., Mammadov R., Taşkın V., (2012). Genetic diversity of natural Cyclamen alpinum populations. Turk. J. Biol.; 36: 413–422. 61. Treu R., Holmes D., Smith B., Aatley D., Johson M. and Trueman L., (2001). Allium amperoprasum Var. babingtonnii (Alliaceae): an Isclonal Plant Found Across a Range of Habitats in S. W. England. 155: 229-235. 62. Watson L. E., Sayed-Ahmed H., Badr A., (2000). Molecular phylogeny of Old World Trifolium (Fabaceae), based on plastid and nuclear markers. Plant. Syst. Evol.; 224 (3-4): 153-171. 63. Williams W. M., (1987). White clover taxonomy and biosystematics. In 'White clover.' (Eds MJ Baker, W M Williams.) 323-342. 64. Williams W. M., Ansari H. A., Ellison N. W., Hussain S. W., (2001). Evidence of three subspecies in Trifolium nigrescens Viv. Ann. Bot.; 87: 683–691. 65. Wojciechowski M. F., Lavin M., Sanderson M. J., (2004). A phylogeny of legumes (Leguminosae) based on analysis of the plastid matK gene resolves many well-supported subclades within the family. Am. J. Bot.; 91: 1846–1862. 54 66. Zhang Q., Saghai Maroof M. A., Allard R. W., (1999). Effects on adaptedness of variations in ribosomal DNA copy number in populations of wild barley (Hordeum vulgare ssp. spontaneum Koch). Proc. Natl. Acad. Sci. U.S.A.; 87: 8741-8745. 67. Zohary M., (1966a). Flora Palaestina. Text Equisetaceae to Moringaceae. Israel Academy of Sciences and Humanities; 1: 364 p. 68. Zohary M., (1966b). Flora Palaestina. Plates Equisetaceae to Moringaceae. Israel Academy of Sciences and Humanities; 1: 495 p. 69. Zohary M., (1972a). Flora Palaestina. Text Platanaceae to Umbelliferae. Israel Academy of Sciences and Humanities; 2: 489 p. 70. Zohary M., (1972b). Flora Palaestina. Plates Platanaceae to Umbelliferae. Israel Academy of Sciences and Humanities; 2: 656 p. 71. Zohary M., (1972). Origins and evolution in the genus Trifolium. Bot. Notiser.; 125(4): 501-511. 72. Zohary M., (1987). Flora Palaestina. Jerusalem, Israel Academy of Science and Humanities; 34-223. 73. Zohary M., Heller D., (1984). The Genus Trifolium. Jerusalem, Israel. Israel Academy of Sciences and Humanities; 606 p. 55 Appendixe Appendix A ITS sequences of the studied Trifolium species MF589956Trifolium purpureum TCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTTACATGCAGACA AACATGTGAATCAGTTTCAACACATAGGGCTGGTTCGAGGTGTTCCCCACCT CGGCTTGCCACTGGTTCGGAGGTGGACGATGCCTTGCGCGTTCCCCTTTGTG CCAAAACACAAACCCCGGCGCTGAATGCGTCAAGGAATTTAAAATTTGCTC TAAGCGCACCTGCATGGCACCGGAGACGGTTTTCGTGCGGGTTGTGTTCTGA CACATAATATAGAATGACTCTCGGCAACGGATATCTAGGCTCTTGCATCGAT GAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAA CCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCATTAGGTTGAGGGCA CGTCTGCCTGGGCGTCACATGTCGAAGCTTCTTGCCAATTTCCTAATGATAG GTATTGTGCAGGGTGAATGTTGGCCTCCCGTGAGCTCCATCGTCTCATGGTT GGTTGAAAATTGAGACCTTGGTAGTTTGTGCCATGATAGATGGTGGTTGTGT TACGCACGAGCCAAAATAAATCATGTGCTGCTCTATCGAATTTTAGCCTCTT TTACCCACATGTGTTTCTAAACGCTCGTGATGAGACCTCAGGTCAGGCGGGG CTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGA MF589957Trifolium purpureum TCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTTACATGCAGACA AACATGTGAATCAGTTTCAACACATAGGGCTGGTTCGAGGTGTTCCCCACCT CGGCTTGCCACTGGTTCGGAGGTGGACGATGCCTTGCGCGTTCCCCTTTGTG CCAAAACACAAACCCCGGCGCTGAATGCGTCAAGGAATTTAAAATTTGCTC TAAGCGCACCTGCATGGCACCGGAGACGGTTTTCGTGCGGGTTGTGTTCTGA CACATAATATAGAATGACTCTCGGCAACGGATATCTAGGCTCTTGCATCGAT GAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAA CCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCATTAGGTTGAGGGCA CGTCTGCCTGGGCGTCACATGTCGAAGCTTCTTGCCAATTTCCTAATGATAG GTATTGTGCAGGGTGAATGTTGGCCTCCCGTGAGCTCCATCGTCTCATGGTT GGTTGAAAATTGAGACCTTGGTAGTTTGTGCCATGATAGATGGTGGTTGTGT TACGCACGAGCCAAAATAAATCATGTGCTGCTCTATCGAATTTTAGCCTCTT TTACCCACATGTGTTTCTAAACGCTCGTGATGAGACCTCAGGTCAGGCGGGG CTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGA MF589958Trifolium purpureum TCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTTACATGCAGACA AACATGTGAATCAGTTTCAACACATAGGGCTGGTTCGAGGTGTTCCCCACCT CGGCTTGCCACTGGTTCGGAGGTGGACGATGCCTTGCGCGTTCCCCTTTGTG CCAAAACACAAACCCCGGCGCTGAATGCGTCAAGGAATTTAAAATTTGCTC TAAGCGCACCTGCATGGCACCGGAGACGGTTTTCGTGCGGGTTGTGTTCTGA CACATAATATAGAATGACTCTCGGCAACGGATATCTAGGCTCTTGCATCGAT GAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAA CCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCATTAGGTTGAGGGCA CGTCTGCCTGGGCGTCACATGTCGAAGCTTCTTGCCAATTTCCTAATGATAG GTATTGTGCAGGGTGAATGTTGGCCTCCCGTGAGCTCCATCGTCTCATGGTT GGTTGAAAATTGAGACCTTGGTAGTTTGTGCCATGATAGATGGTGGTTGTGT TACSCACGAGCCAAAATAAATCATGTGCTGCTCTATCGAATTTTAGCCTCTT 56 TTACCCACATGTGTTTCTAAACGCTCGTGATGAGACCTCAGGTCAGGCGGGG CTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGA MF589959Trifolium purpureum TCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTTACATGCAGACA AACATGTGAATCAGTTTCAACACATAGGGCTGGTTCGAGGTGTTCCCCACCT CGGCTTGCCACTGGTTCGGAGGTGGACGATGCCTTGCGCGTTCCCCTTTGTG CCAAAACACAAACCCCGGCGCTGAATGCGTCAAGGAATTTAAAATTTGCTC TAAGCGCACCTGCATGGCACCGGAGACGGTTTTCGTGCGGGTTGTGTTCTGA CACATAATATAGAATGACTCTCGGCAACGGATATCTAGGCTCTTGCATCGAT GAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAA CCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCATTAGGTTGAGGGCA CGTCTGCCTGGGCGTCACATGTCGAAGCTTCTTGCCAATTTCCTAATGATAG GTATTGTGCAGGGTGAATGTTGGCCTCCCGTGAGCTCCATCGTCTCATGGTT GGTTGAAAATTGAGACCTTGGTAGTTTGTGCCATGATAGATGGTGGTTGTGT TACGCACGWGCCAAAATAAATCATGTGCTGCTCTATCGAATTTTAGCCTCTT TTACCCACATGTGTTTCTAAACGCTCGTGATGAGACCTCAGGTCAGGCGGGG CTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGA MF589960Trifolium purpureum TCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTTACATGCAGACA AACATGTGAATCAGTTTCAACACATAGGGCTGGTTCGAGGTGTTCCCCACCT CGGCTTGCCACTGGTTCGGAGGTGGACGATGCCTTGCGCGTTCCCCTTTGTG CCAAAACACAAACCCCGGCGCTGAATGCGTCAAGGAATTTAAAATTTGCTC TAAGCGCACCTGCATGGCACCGGAGACGGTTTTCGTGCGGGTTGTGTTCTGA CACATAATATAGAATGACTCTCGGCAACGGATATCTAGGCTCTTGCATCGAT GAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAA CCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCATTAGGTTGAGGGCA CGTCTGCCTGGGCGTCACATGTCGAAGCTTCTTGCCAATTTCCTAATGATAG GTATTGTGCAGGGTGAATGTTGGCCTCCCGTGAGCTCCATCGTCTCATGGTT GGTTGAAAATTGAGACCTTGGTAGTTTGTGCCATGATAGATGGTGGTTGTGT TACGCACGWGCCAAAATAAATCATGTGCTGCTCTATCGAATTTTAGCCTCTT TTACCCACATGTGTTTCTAAACGCTCGTGATGAGACCTCAGGTCAGGCGGGG CTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGA MF589961Trifolium campestre TCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTTACATATCTAACA CGTGAATAAGTTTGGACACATAAGGTTGGCTTGAGATGTTCAACACCTCGG CTGACCTCTGGTTTGGAGGTGGATGTTGAAATGCGTTCTCCTTTATTGCCAA AACTCAAACCCCGGCGCTGAATGCGTCAAGGAATTTAAAAGTTGGTTTGAG CGCACCTGCATGCATCCGGAGACGGTTTTGCTTGTGGGTTGTGTTTTTACAC ATGTTATAGAATGACTCTCGGCAACGGATATCTAGGCTCTTGCATCGATGAA GAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCA TCGAGTCTTTGAACGCAAGTTGCGCCCAATGCCATTAGGTTGAGGGCACGTC TGCCTGGGTGTCACATATCGAAGCCTTTTGCCAATTTCCTATTCTTAGGTGTT GTGCAGGGTGAATGTTGGCCTCCCGTGAGCTCTCTTGTCCCATGGTTGGTTG AAAATTGATGCCTCGGTAGCGTGAGCCATGATAGATGGTGGTTGTGCGACC CACAAAACCAAATCATGTGCCAGCTCTATCGAATTTTACCCACATGCGTTAA TAAACGCTCGTGATGAGACCTCAGGTCAGGCGGGGCTACCCGCTGAATTTA AGCATATCAATAAGCGGAGGA MF589962Trifolium campestre TCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTTACATATCTAACA CRTGAATAAGTTTGGACACATAAGGTTGGCTTGAGATGTTCAACACCTCGGC 57 TGACCTCTGGTTTGGAGGTGGATGTTGAAATGCGTTCTCCTTTATTGCCAAA ACTCAAACCCCGGCGCTGAATGCGTCAAGGAATTTAAAAGTTGGTTTGAGC GCACCTGCATGCATCCGGAGACGGTTTTGCTTGTGGGTTGTGTTTTTACACA TGTTATAGAATGACTCTCGGCAACGGATATCTAGGCTCTTGCATCGATGAAG AACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCAT CGAGTCTTTGAACGCAAGTTGCGCCCAATGCCATTAGGTTGAGGGCACGTCT GCCTGGGTGTCACATATCGAAGCCTTTTGCCAATTTCCTATTCTTAGGTGTTG TGCAGGGTGAATGTTGGCCTCCCGTGAGCTCTCTTGTCCCATGGTTGGTTGA AAATTGATGCCTCGGTAGCGTGAGCCATGATAGATGGTGGTTGTGCGACCC ACAAAACCAAATCATGTGCCAGCTCTATCGAATTTTACCCACATGCGTTAAT AAACGCTCGTGATGAGACCTCAGGTCAGGCGGGGCTACCCGCTGAATTTAA GCATATCAATAAGCGGAGGA MF589963Trifolium stellatum TCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTTACATGCAGACC AACACGTGAATTAGTTTGAACACATAGGGTTGGTTTGAGGTGTTCAACACCT TGGCTTGCCTTTGGTTTGGAGGATGACCACTTGTGCGTCCTCCTTTGTGCCA AAACAAAACCCCGGCGCTAAATGCGTCAAGGAATTTAAATTTTGATCTGAG CGCGCACTTGCATGCCACCGGAGTCGGTGTTCGTGCGGTTTGTGTTCTGACA CATAATATAGAATGACTCTCGACAACGGATATCTAGGCTCTTGCATCGATGA AGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACC ATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCATTCGGTTGAGGGCACGT CTGCCTGGGCGTCACATATCGAAGCCTCTTGCCAATTTCCTATTGATGGGGA TTGTGTAGGATGATGCTGGCCTCCCATGAGCTCCATTGTCTCATGGTTGGTT GAAAATCGAGACCTTGGTAGAGTGTGCCATGATAGATGGTGGATGTGTTAT GCATGAGACCAAATAATCATGTGCTACTCTATTGAATTTAGCCTTTTTTTAC CCAAATGCGTTTCTAAACGCTCGTGATGAGACCTCAGGTCAGGCGGGGCTA CCCGCTGAATTTAAGCATATCAATAAGCGGAGGA MF589964Trifolium stellatum TCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTTACATGCAGACC AACACGTGAATTAGTTTGAACACATAGGGTTGGTTTGAGGTGTTCAACACCT TGGCTTGCCTTTGGTTTGGAGGATGACCACTTGTGCGTCCTCCTTTGTGCCA AAACAAAACCCCGGCGCTAAATGCGTCAAGGAATTTAAATTTTGATCTGAG CGCGCACTTGCATGCCACCGGAGTCGGTGTTCGTGCGGTTTGTGTTCTGACA CATAATATAGAATGACTCTCGACAACGGATATCTAGGCTCTTGCATCGATGA AGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACC ATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCATTCGGTTGAGGGCACGT CTGCCTGGGCGTCACATATCGAAGCCTCTTGCCAATTTCCTATTGATGGGGA TTGTGTAGGATGATGCTGGCCTCCCATGAGCTCCATTGTCTCATGGTTGGTT GAAAATCGAGACCTTGGTAGAGTGTGCCATGATAGATGGTGGATGTGTTAT GCATKAGACCAAATAATCATGTGCTACTCTATTGAATTTAGCCTTTTTTTAC CCAAATGCGTTTCTAAACGCTCGTGATGAGACCTCAGGTCAGGCGGGGCTA CCCGCTGAATTTAAGCATATCAATAAGCGGAGGA MF589965Trifolium stellatum TCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAWGCCTTACATGCAGACC AACACGTGAATTAGTTTGAACACATAGGGTTGGTTTGAGGTGTTCAACACCT TGGCTTGCCTTTGGTTTGGAGGATGACCACTTGTGCGTCCTCCTTTGTGCCA AAACAAAACCCCGGCGCTAAATGCGTCAAGGAATTTAAATTTTGATCTGAG CGCGCACTTGCATGCCACCGGAGTCGGTGTTCGTGCGGTTTGTGTTCTGACA CATAATATAGAATGACTCTCGACAACGGATATCTAGGCTCTTGCATCGATGA AGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACC 58 ATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCATTCGGTTGAGGGCACGT CTGCCTGGGCGTCACATATCGAAGCCTCTTGCCAATTTCCTATTGATGGGGA TTGTGTAGGATGATGCTGGCCTCCCATGAGCTCCATTGTCTCATGGTTGGTT GAAAATCGAGACCTTGGTAGAGTGTGCCATGATAGATGGTGGATGTGTTAT GCATGAGACCAAATAATCATGTGCTACTCTATTGAATTTAGCCTTTTTTTAC CCAAATGCGTTTCTAAACGCTCGTGATGAGACCTCAGGTCAGGCGGGGCTA CCCGCTGAATTTAAGCATATCAATAAGCGGAGGA MF589966Trifolium dasyurum TCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTTACATGCAGACA AACATGTGAATCAGTTTCAACACATAGGGCTGGTTCGAGGTGTTCCCCACCT CGGCTTGCCACTGGTTCGGAGGTGGACGATGCCTTGCGCGTTCCCCTTTGTG CCAAAACGCAAACCCCGGCGCTGAATGCGTCAAGGAATTTAAAATTTGCTC TAAGCGCACCTGCATGGCACCGGAGACGGTTTTCGTGCGGGTTGTGTTCTGA CACATAATATAGAATGACTCTCGGCAACGGATATCTAGGCTCTTGCATCGAT GAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAA CCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCATTAGGTTGAGGGCA CGTCTGCCTGGGCGTCACATGTCGAAGCTTCTTGCCAATTTCCTAATGATAG GTATTGTGCAGGGTGAATGTTGGCCTCCCGTGAGCTCCATCGTCTCATGGTT GGTTGAAAATTGAGACCTTGGTAGTTTGTGCCATGATAGATGGTGGTTGTGT TACGCACGAGCCAAAATAAATCATGTGCTGCTCTATCGAATTTTAGCCTCTT TTACCCACATGTGTTTCTAAACGCTCGTGATGAGACCTCAGGTCAGGCGGGG CTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGA MF589967Trifolium dasyurum TCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTTACATGCAGACA AACATGTGAATCAGTTTCAACACATAGGGCYGGTTCGAGGTGTTCCCCACCT CGGCTTGCCACTGGTTCGGAGGTGGACGATGCCTTGCGCGTTCCCCTTTGTG CCAAAACGCAAACCCCGGCGCTGAATGCGTCAAGGAATTTAAAATTTGCTC TAAGCGCACCTGCATGGCACCGGAGACGGTTTTCGTGCGGGTTGTGTTCTGA CACATAATATAGAATGACTCTCGGCAACGGATATCTAGGCTCTTGCATCGAT GAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAA CCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCATTAGGTTGAGGGCA CGTCTGCCTGGGCGTCACATGTCGAAGCTTCTTGCCAATTTCCTAATGATAG GTATTGTGCAGGGTGAATGTTGGCCTCCCGTGAGCTCCATCGTCTCATGGTT GGTTGAAAATTGAGACCTTGGTAGTTTGTGCCATGATAGATGGTGGTTGTGT TACGCACGAGCCAAAATAAATCATGTGCTGCTCTATCGAATTTTAGCCTCTT TTACCCACATGTGTTTCTAAACGCTCGTGATGAGACCTCAGGTCAGGCGGGG CTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGA 59 جامعة النجاح الوطنية كمية الدراسات العميا دراسة العالقة الوراثية التطورية بين األنواع المتقاربة التابعة لجنس البرسيم (Trifolium - .في فمسطين/ الضفة الغربية )عائمة البقوليات إعداد رنا مالك محمد حسان إشراف د.غدير عمر د.غالب عدوان هذه األطروحة استكماال لمتطمبات الحصول عمى درجة الماجستير في العموم الحياتيةقدمت فمسطين. -نابمس ،في جامعة النجاح الوطنية ،الدراسات العميا بكمية 2012 ب دراسة العالقة الوراثية التطورية بين األنواع المتقاربة التابعة لجنس البرسيم (Trifolium -في فمسطين/ الضفة الغربية.عائمة البقوليا )ت إعداد رنا مالك محمد حسان إشراف د.غدير عمر د.غالب عدوان الممخص تعد عائمة البقوليات أو القرنيات ثالث أكبر عائمة في النباتات المزىرة ) كاسيات البذور( التي تشمل مزىرة داخل عائمة نباتات البقوليات ىي .فوالوات ( ,السنطوات ,ثالث عوائل : )البقموات ىو واحد ( .Trifolium Lجنس البرسيم ) .القرنيات التي تضم عدد كبير من األصناف المختمفة منطقة البحر األبيض .من أكبر األجناس التابعة لعائمة البقوليات ذات أىمية زراعيو كبيرة يعود إلى تمك األصمي البرسيم إنتشارلذلك ،المتوسط تضم أعمى تنوع حيوي وذلك بسب المناخ .المنطقة الصفات الشكمية لبعض األنواع المتقاربة التابعة لجنس العقبات في التصنيف المعتمد عمىلحل Internalمناطق ) .( كان من الضروري إستخدام التقنيات الجزيئية Trifoliumالبرسيم ) Transcribed Spacer /ITS ىي من أكثر العالمات استخداما في البحوث النباتية لقدرتيا ) .في دراسة النشوء و التطور خاصة في عائمة البقولياتعمى أن تكون مصدر مفيد لممعمومات خالل فترة اإلزدىار البرسيمتم تجميع عينات نباتية من بعض األنواع التابعة لجنس مختمفة في فمسطين / الضفة الغربية و من ثم تم تصنيف ىذه ( من مواقع 2012مايو -)مارس وتم حفظ عينة لكل ،( Flora Palaestinaالعينات اعتمادا عمى الصفات الشكمية و رجوعا إلى ) .في معشبة جامعة النجاح الوطنية/ نابمس األنواع المدروسة ج تم تحديد ثم . (CTAB( من األوراق باستخدام )DNAتم استخالص الحمض النووي ) ( لتكثير و معرفة تسمسل منطقة ITS1, 5.8S, ITS2نية باستخدام البادئات )يالخصائص الج (ITS ). قدر األختالف بين تسمسل الجينات و أنشأت شجرة النشوء و التطور باستخدام نماذج Kimura's 2- parameter وNeighbor-joining method أودعت كل من .عمى التوالي ( في قاعدة بيانات في بنك الجينات تحت Trifoliumاإلثنَا َعَشَر عينة التابعة لجنس البرسيم ) .أرقام اإلنضمام ىي أنواع T.daysurumو T.purpureumالجزيئية بأن كل من ITSأثبت تحميل تسمسل في (Ia)مجوعة Iو كما تجمعت في فرع واحد .متطابقة ITSألن لدييم تسمسل .متطابقة أيضا .ىذا يتزامن مع وجود تشابو كبير في الصفات الشكمية لدييم .شجرة النشوء و التطور T.campestre وT.grandiflorum (DQ312062.1) يمكن إعتبارىما تصنيفيا كنوع واحد ( في شجرة IIb)مجموعة IIكما و تجمعت في فرع واحد ،متطابقة ITSألن لدييم تسمسل و ذلك النشوء و التطور . كنوع T.daysurumو T.purpureumفأنو يوصى بالتعريف عن ،بناء عمى ىذة الدراسة ىو مرادف T.daysurum (1332فأن ) ،العالمي التسمياتنظام واحد وتبعا لقواعد (1302)T.purpureum . ( 1304) عمى التسميات أيضا كما و يتم تطبيق قاعدة T.campestre (1272و )T.grandiflorum عمى أن يكونT.campestre مرادف T.grandiflorum . تعتبر ىذه الدراسة الجامعة بين التصنيف الشكمي التقميدي و التصنيف الجزيئي األولى من نوعيا في البرسيم ض األنواع المتقاربة التابعة لجنس علتسميطيا الضوء عمى العالقة التطورية بين ب وىذا يميد الطريق لبحوت مستقبمية أخرى متعمقة في مختمف األنواع .فمسطين/ الضفة الغربية كشف عن ياستخدام عالمات جزيئية أخرى يمكن أن ،باألضافة إلى ذلك .التابعة لنفس الجنس .(Trifoliumزيد من التوضيح لتصنيف األنواع األخرى من جنس البرسيم )الم