An - Najah Univ. J. Res. (N. Sc.) Vol. 23, 2009 Palestinian Isolate of Tomato Yellow Leaf Curl Virus: Capsid and Nucleic Acid Retention in Bemisia tabaci, Transmission, and Field Study of Virus Association with the Vector and Non-Vector Insects Hazem Sawalha Department of Biology and Biotechnology, Faculty of Arts and Sciences, Arab American University, Jenin, Palestine E-mail: hsawalha@aauj.edu Received: (6/4/2009), Accepted: (30/9/2009) I- Abstract Studying the retention of nucleic acid of the Palestinian isolate of the tomato yellow leaf curl virus in the whitefly vector, Bemisia tabaci, by using the polymerase chain reaction (PCR) showed, on one hand, that the viral DNA was retained for at least 24 days after the 48-hours of acquisition access on TYLCV-infected tomato plants. On the other hand, enzyme-linked immunosorbent assays (ELISA) revealed that the virus's antigen persisted for only eleven days, which is much shorter than the retention of the virus’s genome. This feature proved that there is a close relationship between the capsid’s retention in the whitefly vector and the virus’s transmissibility which remained for eleven days. In addition, In Vitro studies proved that the non-vector insects including whitefly, 94 “Palestinian Isolate of Tomato Yellow Leaf Curl Virus: …” An - Najah Univ. J. Res. (N. Sc.) Vol. 23, 2009 Trialiorodes vaporariorum, and aphids, Myzus persicae, Aphis gossypii and Macrosiphum pisi can also acquire both the viral DNA and the capsid, when given 48-hour acquisition access on infected tomato. Furthermore, studying the viruliferous B. tabaci collected from tomato fields in Al-Far'a region revealed high association of both the viral DNA and the capsid compared with those collected from eggplants near tomato fields which showed low association. This research also proved that the above mentioned non-vector insects pointed out above have the ability to acquire the virus under field conditions with various rates. Therefore, the maximum acquisition of the viral DNA recorded in T. vaporariorum collected from Al-Far'a region was found to be 50%. Key words: Tomato yellow leaf curl virus, Bemisia tabaci, TYLCV- genome, TYLCV-capsid -II . . (Trialiorodes vaporariorum)(Myzus persicae) (Aphis gossypii) (Macrosiphum pisi) . Hazem Sawalha 95 An - Najah Univ. J. Res. (N. Sc.) Vol. 23, 2009 %%. %. III- Introduction Tomato yellow leaf curl virus (TYLCV) is the most devastating viral disease affecting tomato (Lycopersicon esculentum Mill) cultivation in several Mediterranean countries (Pico et. al., 1996, p. 151-196, Czosnek et. al., 1990, p. 1-6). The virus is considered to be the most serious viral disease complex of cultivated tomato crops in tropical and warm temperate regions of the world, where losses up to 100% are incurred (Moriones et. al. 2000, p. 123–134, Czosnek et. al., 2001, p. 291–322). TYLCV was first reported in Israel in the 1960s (Pico et .al. 1996, p. 291–322). In Palestinian territories, Sawalha (2009a) studied the virus occurrence on solanaceous hosts and the distribution of the virus natural reservoirs in summer season in North West bank. In addition, the virus incidence in tomato fields grown in the northern regions of west bank was also studied (Sawalha 2009c). In Jordan, the disease is responsible for severe crop damage, especially for tomato grown during the fall seasons in the Jordan Valley (Al-Musa, 1982, p. 361-363). Weakening of the whole tomato plant, flower and fruit abscission caused by the viral infection result in serious yield losses. These losses are particularly severe when the infection occurs before flowering. Since 96 “Palestinian Isolate of Tomato Yellow Leaf Curl Virus: …” An - Najah Univ. J. Res. (N. Sc.) Vol. 23, 2009 fruits often do not attain the appropriate commercial size, size reduction of fruits may also cause a decrease in quality (Pico et. al., 1996, p. 291– 322). The disease, which is caused by a monopartite Gemini virus (Fauquet et. al. 2003, p. 405-421, Czosnek et. al. 1988, p. 1-6) is readily transmitted by a whitefly vector, Bemisia tabaci (Genn) (Kashina et al., 2003, p. 188–199, Brown and Czosnek, 2002, p. 65–100). The virus is transmitted by the vector in a persistent and circulative manner by which the vector remains inoculative for several days after it acquires the virus (Pico et. al. 1996, p. 291–322, Oetting and Yunis, 2004, p. 68-69). The virus is the first reported whitefly-transmitted Gemini-virus possessing a single genomic component, but it is unusually heterogeneous and some isolates have two genomic components (Rochester et. al., 1994, p. 477- 485). Since TYLCV is a very serious disease affecting tomato cultivation in Palestine (Sawalha, unpublished data), this research describes the relationship between the Palestinian isolate of TYLCV with its vector, B. tabaci, and provides additional information in this regard by studying the retention of both genomic DNA and the capsid of the virus in the vector under lab and field conditions using the methods of polymerase chain reaction (PCR) and the enzyme-linked immunosorbent assays (ELISA), respectively. In addition, this research also demonstrates the possibility of virus acquisition by a non-vector whitefly, Trialeurodes vaporariorum and aphids including Muzus persicae Sulzer, Aphis gossypii Glover and Macrosiphum pisi Kalt. under lab and field conditions. In addition, the Hazem Sawalha 97 An - Najah Univ. J. Res. (N. Sc.) Vol. 23, 2009 likelihood and feasibility of using both PCR and ELISA tests for monitoring the viruliferous whiteflies under field conditions is also evaluated. IV- Materials and Methods Virus Source Samples of young stems were collected from tomato plants showing TYLCV symptoms of yellowing and upward leaf curling in Al-Far'a region (Tobas district). Scions obtained from the collected samples were cleft grafted onto rootstocks of healthy tomato plants during the 3rd or 4th true leaf stage. The grafts were then held firm with plastic clips (Marsic and Osvald, 2004, p. 243-249). The inoculated plants were grown in glasshouse under insect-free conditions. The virus was identified based on virus transmissibility, host range, PCR and serological tests as discussed below. Collection and Rearing of B. Tabaci Adult whiteflies, B. tabaci, were collected from eggplant fields grown in Al-Far'a region. The colonies of the insects were reared in muslin-covered woody cages containing TYLCV-immune plants including eggplants, cauliflower and pumpkin. The cages were housed in an insectary glasshouse at a temperature of about 29 °C (Jetter et. al. 2001, p. 1-60, Gerling, 1990, p. 57-112). The first generation of the insects was obtained by transferring the pupae into other cages containing the TYLCV-non-hosts as mentioned above. Whitefly rearing 98 “Palestinian Isolate of Tomato Yellow Leaf Curl Virus: …” An - Najah Univ. J. Res. (N. Sc.) Vol. 23, 2009 on TYLCV-immune plants continued for 25 days (Gerling, 1990, p. 57- 112). TYLCV Acquisition by B. Tabaci The adult whiteflies that emerged during the same 48 hours were collected, and random samples were checked for TYLCV using both ELISA and PCR as mentioned below. After assuring the nonviruliferous case of the whiteflies, they were caged with TYLCV-infected tomato plants. The insects were then given a 48-hour acquisition feeding period then transferred and reared on pumpkin plants for the rest of their lives. B. Tabaci Transmission of TYLCV Forty viruliferous whitefly samples were transferred daily from pumpkin plants into cages of healthy tomato plants and were given a 48- hour inoculation feeding period before they were sprayed with an insecticide. The symptoms of TYLCV were recorded and then the plants were tested by PCR for virus infection as discussed below. Hazem Sawalha 99 An - Najah Univ. J. Res. (N. Sc.) Vol. 23, 2009 Sampling of Viruliferous B. Tabaci for Lab Testing Similarly, samples of thirty insects were collected daily from pumpkin plants as described above and stored at –20 °C until the end of the experiments. Five insects from the collected samples were kept in 0.5 ml eppendorf tubes for DNA analysis while the rest were put in Falcon tubes for capsid analysis. Retention of the Viral DNA in B. Tabaci PCR-based method was employed to check the presence of the viral DNA genome in the insects. The procedure of the PCR-based method was conducted as described by Navot et. al. (1992, p. 1199-1202), Sawalha (2009b, p. 28) and Tortora et. al. (2002, p. 254-255). The sequence of TYLCV specific primers (from 5’ to 3’) were P1V, ATACTTGGACACCTAATGGC, nucleotides (nt) 61-80, and P4C, TGGACATCT AGACCTAAG, nt. 2054-2071. The sequence of primer P1V corresponds to the viron positive strand whereas primer P4C is complementary to the viron strand. The reaction was run for 35 cycles using the PTC-100 Peltier thermal cycler. The amplified PCR products were electrophoresed for 90 minutes and then photographed. Retention of the Viral Capsid in B. Tabaci The triple antibody enzyme linked Immunosorbent assay (TAS- ELISA) was carried out as described by Sawalha et. al. (2000, p. 339) and Pico et. al. (1999, p. 1006-1012). The whiteflies were extracted at a proportion of 1/10 (w/v) as suggested by Adgen Ltd (Scotland UK) 100 “Palestinian Isolate of Tomato Yellow Leaf Curl Virus: …” An - Najah Univ. J. Res. (N. Sc.) Vol. 23, 2009 through personal communication. The antibodies were cross-absorbed overnight with acetone-washed non-viruliferous whiteflies. In addition, each ELISA plate contains control samples as follows: six negative control samples of extract obtained from whiteflies reared on healthy pumpkin plants for at least two generations, four positive control samples of extracts obtained from whiteflies fed for 48 hours on TYLCV-infected tomato plants, and three samples of the buffer used in whitefly extraction. Non–Specific Acquisition of TYLCV by Non-Vector Insects Adult whiteflies of T. vaporariorum and aphids of M. persicae, A. gossypii and M. pisi were collected from cucumber, squash and eggplant fields in Al-Far'a region. The whiteflies were identified according to Gerling (1990, p. 57-112) then reared on pumpkin for several generations. Similarly, the aphids were identified according to Oetting and Yunis (2004, p. 68-69) and reared on cucumber, eggplants, pepper and squash for several generations. Adult whiteflies and aphids were selected randomly and given 48 hour acquisition access on TYLCV- infected tomato, then removed and stored at -20 °C for laboratory analysis. Both PCR and ELISA tests were used as shown above to check the acquisition of the viral DNA genome and capsid respectively. Detection of Viral DNA and Capsid from B. Tabaci in Vivo Samples of B. tabaci were collected in the middle of July 2003 from tomato growing sites in Al-Far'a region. The samples were collected Hazem Sawalha 101 An - Najah Univ. J. Res. (N. Sc.) Vol. 23, 2009 using aspirator as follows: 100 samples from tomato fields, 100 samples from natural flora beside tomato fields, and 100 samples from eggplant fields near tomato fields. The samples were then transferred to the lab and analyzed as indicated above for the viral DNA and capsid using PCR and ELISA respectively. Detection of Viral DNA and Capsid from Non-Vector Insects in Vivo Insect samples were collected from natural flora growing beside tomato fields in Al-Far'a region using a handheld vacuum insect sucker (vacuum sampling). The samples were identified, and 100 samples were selected randomly from each type of T. vaporariorum, M. persicae, A. gossypii and M. pisi. The samples were analyzed for the DNA of the virus using PCR as pointed above. Statistical Analysis Analysis of the data was conducted using the Two-Sample Tests of Proportions according to Lind et. al. (2005, p. 262-263). The results were analysed using a level of significance when = 0.05. Statistical analysis was done based on Dr. Elias Dabeet's recommendations, Department of Mathematics & Statistics, Faculty of Arts & Sciences, Arab American University of Jenin. 102 “Palestinian Isolate of Tomato Yellow Leaf Curl Virus: …” An - Najah Univ. J. Res. (N. Sc.) Vol. 23, 2009 V- Results B. Tabaci Transmission of TYLCV Observing the symptoms of TYLCV on tomato plants showed that the whiteflies were able to transmit the virus for 11 days after they were given a 48 hour access feeding period on infected tomato plants. Infected plants are severely stunted. Shoots become erect. Leaflets are reduced in size, curl upwards and become distorted. Flowers wither, and plants set very few fruit. Continuous reduction in the transmission efficiency was achieved as time progressed until the minimum value 11 days after virus acquisition (Fig. 1) Figure 1: The ability of viruliferous B. tabaci to transmit TYLCV following rearing on TYLCV-immune plants for several days 0 20 40 60 80 100 120 2 3 4 5 6 7 8 9 10 11 12 13 Days Pe rc en ta ge o f i nf ec ti on Replicate 1 Replicate 2 Replicate 3 a b c d e f g h i j * Values marked with the same letter do not differ significantly according to Two-Sample Tests of Proportions ( = 0.05) Hazem Sawalha 103 An - Najah Univ. J. Res. (N. Sc.) Vol. 23, 2009 Retention of the Viral DNA in B. Tabaci The retention of the viral DNA in Bemisia tabaci was investigated for at least four weeks. Therefore, it was concluded that the viral DNA was readily detected in the whitefly for up to at least 24 days after 48 hours of acquisition access. PCR signals were strong as appeared on electrophoresis gel starting from the first day after removal from the virus source until collecting the last sample 24 days later. No DNA amplification occurred when PCR was conducted for the nucleic acid extract from the whiteflies reared on healthy pumpkin plants. The fragment size of the amplified PCR product was typical to that obtained by TYLCV amplification (Plate 1). Plate (1): Gel electrophoreses of the PCR products obtained by amplification of TYLCV DNA from B. tabaci cultured on pumpkin plants. Samples were taken from the culture at different periods. Lane A: Lambda Hind III DNA size marker. Lanes 4-25: Days of viruliferous whitefly culturing on pumpkin. Primers are P1V/P4C. 104 “Palestinian Isolate of Tomato Yellow Leaf Curl Virus: …” An - Najah Univ. J. Res. (N. Sc.) Vol. 23, 2009 Retention of the Viral Capsid in B. Tabaci After conducting the ELISA test and investigating the viral capsid’s retention of TYLCV, the results showed that the capsid of TYLCV was detected two days later in the viruliferous whiteflies reared on pumpkin after removal from the virus source. In addition, quantitative measuring of ELISA plates at 405nm revealed that the amount of virus antigen decreases continually by time as the insect feeds on TYLCV immune plants. Therefore, the ELISA readings achieved the maximum value two days after removing the insect from the virus source, then the reading values started decreasing until the eleventh day when they became very close to the reading values obtained by the non-viruliferous whiteflies (Fig:2). Figure 2: ELISA detection of TYLCV capsid in B. tabaci reared on TYLCV- immune plants for several days 0 0.1 0.2 0.3 0.4 0.5 0.6 2 3 4 5 6 7 8 9 10 11 12 13 Days A bs or ba nc e at 4 05 n m Replicate 1 Replicate 2 Replicate 3 Non-viruliferous a a a b b c c d d e * Values marked with the same letter do not differ significantly according to Two-Sample Tests of Proportions ( = 0.05). Hazem Sawalha 105 An - Najah Univ. J. Res. (N. Sc.) Vol. 23, 2009 Non-Specific Acquisition of TYLCV by Non-Vector Insects The results of the PCR-based method proved that the adult T. vaporariorum and the adult aphids including M. pesricae, A. gossypii and M. pisi could acquire the viral DNA non-specifically since the extracts of these insects contained DNA that annealed with TYLCV-specific primers. Also, the number of DNA bands formed in gel electrophoreses elucidated that such insects acquire the virus in a high rate hence most of the tested insects were found carriers for the viral DNA genome (Plate 2). Plate (2): Gel electrophoreses of PCR amplified TYLCV genome from non-vector insects fed on TYLCV-infected tomato plants (lanes 2-5). Lane 2: A. gossypii, lane: 3: T. vaporariorum, lane 4: M. persicae, lane 5: M. pisi. Lanes 6 & 7: Insect mixture fed on TYLCV-free tomato plants. Lane 1: 500 base DNA size marker. Primers are P1V/P4C. Furthermore, serological assays revealed that these insects could also acquire the virus antigen after the 48 hour acquisition feeding period on the virus source plants as indicated by ELISA. 106 “Palestinian Isolate of Tomato Yellow Leaf Curl Virus: …” An - Najah Univ. J. Res. (N. Sc.) Vol. 23, 2009 Detection of Viral DNA and Capsid from B. Tabaci in Vivo PCR and ELISA showed that the maximum viral occurrence occurs in the whiteflies collected from tomato fields followed by whiteflies collected from natural flora beside tomato fields, and finally the whiteflies collected from eggplants near tomato fields. The viral DNA and capsid occurrence collected from tomato fields, natural flora, and eggplants was found to be 95/90, 61/40 and 20/8 respectively. The occurrence of viral DNA was greater than the occurrence of capsid for all samples (Fig 3). Figure 3: DNA and capsid of TYLCV in B. tabaci collected from tomato fields, natural flora beside tomato fields and eggplant fields near tomato fields in Al-Far' a region 0 10 20 30 40 50 60 70 80 90 100 Whiteflies collected from tomato fields Whiteflies collected from natural flora beside tomato fields Whiteflies collected from eggplant fields beside tomato fields Site of collection Pe rc en ta ge o f B . t ab ac i w it h D N A an d c ap si d DNA Capsid a1 a b c {a} {c} {b} * Values marked with the same letter do not differ significantly according to Two-Sample Tests of Proportions ( = 0.05). DNA columns were compared with each other and the same was done for the capsid columns. Hazem Sawalha 107 An - Najah Univ. J. Res. (N. Sc.) Vol. 23, 2009 Detection of Viral DNA and Capsid from Non-Vector insects in Vivo The PCR tests revealed that the viral DNA associated with all insect samples collected from natural flora beside tomato fields in Al-Far'a region. The maximum occurrence of DNA was obtained from T. vaporariorum (53%) followed by M. persicae (10%), A. gossypii (9%) and M. pisi (6%) (Fig 4). Figure 4: Percentage of non-vector insects that acquire TYLCV DNA collected from natural flora beside tomato fields in Al-Far' a region 0 10 20 30 40 50 60 T. vaporariorum M. persicae A. gossypii M. pisum Insect Pe rc en ta ge o f i ns ec ts w it h th e vi ru s D N A a b b b * Values marked with the same letter do not differ significantly according to Two-Sample Tests of Proportions ( = 0.05). 108 “Palestinian Isolate of Tomato Yellow Leaf Curl Virus: …” An - Najah Univ. J. Res. (N. Sc.) Vol. 23, 2009 VI- Discussion This research, based on the study of the retention of the capsid and nucleic acid of the Palestinian isolate of TYLCV in the B. tabaci, revealed that the virus's nucleic acid persisted much longer than that of the virus's capsid. Hence, the complete cessation of the virus capsid in the whitefly vector was achieved eleven days after insect removal from the virus source, whereas the retention of the nucleic acid wasn’t achieved until at least 24 days later. In addition, the results of whitefly transmissibility showed that the whitefly vector, B. tabaci, can inoculate TYLCV until twelve days after they were given the 24 hour acquisition access on the virus infected plants. Therefore, the results suggest a close association between the retention of the virus capsid in the whitefly vector and its ability to transmit and inoculate the virus to assay plants. Consequently, Rubinstein and Czosnek (1997, p. 2683–2689) reported that the viral nucleic acid of the Israeli isolate is retained in the vectors during their entire adult life after 48 hours acquisition access which is far beyond the ability of the insect to disperse the virus. In the same country, Pico et. al. (1996, p. 151-196) reported that the whiteflies can stay inoculative for 20 days after 48 hours acquisition but the virus is not retained through the life span of the insect. With regard to other countries, similar results were obtained by other researchers. In Jordan, Mansour and Al-Musa (1992, p. 122-125) reported that the whiteflies stay inoculative for the Jordanian isolate of TYLCV for 11 days after 48 hours acquisition feeding period on virus-infected plants. On the other hand, Caciagli et. al. (1995, p. 163-170) found that the Sardinian isolate of the same virus persists in the whitefly vector for just 8 days after Hazem Sawalha 109 An - Najah Univ. J. Res. (N. Sc.) Vol. 23, 2009 similar access feeding period. The above results showed that the virus- vector relationships of the Palestinian isolate differ among TYLCV isolates from Israel, Jordan and Sardinia. These differences could reflect the adaptation of the different TYLCV isolates to transmission by different whitefly populations in different geographical origins. Therefore, our finding proved that the Palestinian isolate of TYLCV has its own characteristics that differ from the Jordanian and Israeli isolates. Similar results were reported by other researchers who studied other Gemini viruses. For example, Polston et. al. (1990, p. 850-856) reported that the correlation between the transmission ability of B. tabaci for the squash leaf curl Gemini virus (SLCV) and the detection of the virus antigen was better than the correlation between the virus transmission and the detection of the virus nucleic acid. The difficulty to detect the virus capsid in the vector beyond eleven days after its removal from the virus source may be due to the attachment of the virus to the membrane of salivary glands of the insect which causes a blockage to part of the capsid that therefore lowers the possibility for binding with the specific antibodies (Cohen et. al., 1989, p. 109-113). The field studies showed that the occurrence of the viral DNA in B. tabaci is much greater than occurrence of the capsid. This may be explained according to our conclusion that the whiteflies do not lose the DNA; they rather retain it for long time and possibly even throughout their lifetime. The lower occurrence of the viral capsid compared with 110 “Palestinian Isolate of Tomato Yellow Leaf Curl Virus: …” An - Najah Univ. J. Res. (N. Sc.) Vol. 23, 2009 the DNA was attributed to the gradual loss of the capsid by time as our results proved that the whiteflies did not retain it for more than 11 days. The occurrence of both DNA and capsid in whiteflies collected from tomato fields may be attributed to high amounts of infected plants that provide ample viral source for the whiteflies. The lower occurrence of DNA and capsid in whiteflies collected from natural flora and eggplants was attributed to viral sources which became reduced as the whiteflies moved away from tomato fields to the nearby sites or even to the fields of the virus-immune plants as eggplants. The results showed that the non-vector whiteflies, T. vaporariorum, and aphids, M. persicae, A. gosypii and M. pisi could also acquire both the DNA and the capsid of the virus after they were given a 48 hour acquisition access period. Similarly, Cohen et. al. (1989, p. 109-113) found that the T. abutilouea could acquire the antigen of the SLCV non- specifically at a higher rate compared to its vector B. tabaci. In addition, Polston et. al. (1990, p. 850-856) reported that the same virus (SLCV) could be acquired by the T. vaporariorum, which is a non-vector for the virus. The high occurrence of viral DNA in non-vector insects feeding on natural flora beside tomato fields emphasized our results by proving their ability to acquire the virus nonspecifically. The maximum occurrence of viral DNA in T. vaporariorum compared with the other insects may be attributed to the activity of these whiteflies during the period of collection which enabled them to visit tomato fields regularly. The low Hazem Sawalha 111 An - Najah Univ. J. Res. (N. Sc.) Vol. 23, 2009 DNA acquisition by the tested aphid species was attributed to low flight activity of these insects. Furthermore, the previously stated results indicate that PCR-based techniques could not be employed solely in studying the epidemiology of TYLCV by detecting the rate of inoculative vectors in the whitefly population because inoculativity remained for fewer days than the persistence of the DNA in the vector. Also, T. vaporariorum, which is a non-TYLCV vector, can acquire the virus non-specifically, and therefore hampers the epidemiological studies which depend on monitoring the virus in the whitefly vector. However, T. vaporariorum, M. persicae, A. gossypii and M. pisi that are common in the area of TYLCV can be used by epidemiologists and phyto-pathologists as indicator insects for the presence of TYLCV in the region. VII- References Al-Musa, A. (1982). "Incidence, economic importance and control of tomato yellow leaf curl virus in Jordan". Plant Disease, 66, 361-363. Brown, J. and Czosnek, H. (2002). Whitefly Transmission of Plant Viruses. In RT Plumb, ed, Advances in Botanical Research, Academic Press, New York. Caciagli, P., Bosco, D. and Al-Biter, L. (1995). "Relationships of the Sardinian isolate of tomato yellow leaf curl geminivirus with its vector Bemisia tabaci, Gen."Eur. J. Plant Pathol., 101, 163-170. 112 “Palestinian Isolate of Tomato Yellow Leaf Curl Virus: …” An - Najah Univ. J. Res. (N. Sc.) Vol. 23, 2009 Cohen, S., Duffus, J. and Liu, H. (1989). "Acquisition, interference, and retention of cucurbit leaf curl viruses in whiteflies". Phytopathology,79, 109-113. Czosnek, H., Ber, R., Antignus, Y., Cohen, S., Navot, N. and Zamir, D. (1988). "Isolation of tomato yellow leaf curl virus. A first survey using a specific DNA probes". Phytopathological Mediterranean, 29, 1-6. Czosnek, H., Ghanim, M., Morin, S., Rubinstein, G., Fridman, V. and Zeidan, Z. (2001). "Whiteflies: vectors, and victims (?), of geminiviruses". Adv.Virus Res., 57, 291–322. Czosnek, H., Navot, N. and Laterrot, H. (1990). "Geographical distribution of tomato yellow leaf curl virus. A first survey using a specific DNA probes". Phytopathological Mediterranean, 29, 1-6. Fauquet, M., Bisaro, D., Briddon, R., Brown, J, Harrison, B., Rybicki, E., Stenger, D. & Stanley, J. (2003). "Revision of taxonomic criteria for species demarcation in the family geminiviridae, and an updated list of begomovirus species". Arch Virol., 148, 405-421. Gerling, D. (1990). Whiteflies: their Bionomics, Pest Status and Management. Intercept Ltd. UK. Jetter, K., Alston, J. and Farquharson, R. (2001). Private Investment in Exotic Pest Control Technology. The Case of Silver leaf Whitefly in California. University of California, Agricultural Issues Center. Hazem Sawalha 113 An - Najah Univ. J. Res. (N. Sc.) Vol. 23, 2009 Kashina, B., Mabagala, R. and Mounami, A. (2003). "Biomolecular relationships among isolates of tomato yellow leaf curl Tanzania virus". Phytoparasitica, 31, 188–199. Lind, D., Marchal, W. and Wathen, S. (2005). Statistical Techniques in Business & Economics, Twelfth Edition. McGraw-Hill Irwin, New York. Mansour, A. and Al-Musa, A. (1992). "Tomato yellow leaf curl virus: host range and virus relationships". Plant Pathol., 41, 122-125. Marsic, N. and Osvald, J. (2004). "The influence of grafting on yield of two tomato cultivars (Lycopersicon esculentum Mill.) grown in a plastic house". Acta agriculturae slovenica, 243-249 Moriones, E., and Navas-Castillo, J. (2000). "Tomato yellow leaf curl virus, an emerging virus complex causing epidemics worldwide". Virus Res., 71, 123–134. Navot, N., Zeidan, M., Pichersky, E., Zamir, D. and Czosnek, H. (1992). "Use of the polymerase chain reaction to amplify tomato yellow leaf curl viral DNA from infected plants and viruliferous whiteflies". Plant Pathology, 82, 1199-1202. Oetting, R. and Yunis, H. (2004). Field Guide to Common Insects, Mites, & Diseases of Greenhouse Grown Sweet Peppers, & Tomatoes. Hakohav Press, Kfar Qari. 114 “Palestinian Isolate of Tomato Yellow Leaf Curl Virus: …” An - Najah Univ. J. Res. (N. Sc.) Vol. 23, 2009 Pico, B., Diez, M. and Muez, F. (1996). "Viral disease causing the greatest economic losses to tomato crop. II. The tomato yellow leaf curl virus-a review". Scientia Horticulturae, 67, 151-196. Pico, B., D ez, M. J., and Nuez, F. (1999). "Improved diagnostic techniques for tomato yellow leaf curl virus in tomato breeding programs" Plant Dis., 83, 1006-1012. Polston, J., Al-Musa, A., Perring, T. and Dodds, A. (1990). "Association of the nucleic acid of squash leaf curl geminivirus with the whitefly Bemisia tabaci". Phytopathology, 80, 850-856. Rochester, D., der Paulo, J., Fauquet, C. and Beachy, R. (1994). "Complete nucleotide sequence of the geminivirus tomato yellow leaf curl virus, Thailand isolate". J. Gen. Virol., 75, 477-485. Rubinstein, G. and Czosnek, H. (1997). "Long-term association of tomato yellow leaf curl virus with its whitefly vector Bemisia tabaci: effect on the insect transmission capacity, longevity and fecundity". Journal of General Virology, 78, 2683–2689. Sawalha, H. (2009a). "Occurrence of tomato yellow leaf curl virus on volunteer tomato, jimsonweed and tobacco in North West Bank: Distribution of the virus natural reservoirs in summer season". An Najah University for Research (In Press). Sawalha, H. (2009b). "The use of PCR, IC-PCR, TAS-ELISA, TBIA, and biological methods to determine the time needed to detect TYLCV in inoculated jimsonweeds". The First Conference on Hazem Sawalha 115 An - Najah Univ. J. Res. (N. Sc.) Vol. 23, 2009 Biotechnology Research and Application in Palestine, 3-4 April, 2009, Furno Hall, Bethlehem University, Bethlehem, Palestine, 28. Sawalha, H. (2009c). "Whitefly population and incidence of tomato yellow leaf curl virus in tomato fields grown in the northern regions of the West Bank". Journal of Al-Aqsa University (In Press). Sawalha, H., Mansour, A. and El-Khateeb, M. (2000). "Serological and PCR detection of tomato yellow leaf curl virus from infected plant tissues and whiteflies". Seventh Arab Congress of Plant Protection, 22-26 October 2000, Amman-Jordan, 339 Tortora, G., Funke, B. and Case, C. (2002). Microbiology, An Introduction, Seventh Edition. Benjamin Cummings, New York.